ID: 1012119019

View in Genome Browser
Species Human (GRCh38)
Location 6:95340115-95340137
Sequence TGAGCTCCCAGACCCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119019_1012119022 -8 Left 1012119019 6:95340115-95340137 CCCAGGAAGGGTCTGGGAGCTCA No data
Right 1012119022 6:95340130-95340152 GGAGCTCAGGCTGCTGAACCAGG No data
1012119019_1012119023 -1 Left 1012119019 6:95340115-95340137 CCCAGGAAGGGTCTGGGAGCTCA No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data
1012119019_1012119026 16 Left 1012119019 6:95340115-95340137 CCCAGGAAGGGTCTGGGAGCTCA No data
Right 1012119026 6:95340154-95340176 AAGTGGGTGTTCCAAATGCCTGG No data
1012119019_1012119028 28 Left 1012119019 6:95340115-95340137 CCCAGGAAGGGTCTGGGAGCTCA No data
Right 1012119028 6:95340166-95340188 CAAATGCCTGGAGATCTACCTGG No data
1012119019_1012119024 0 Left 1012119019 6:95340115-95340137 CCCAGGAAGGGTCTGGGAGCTCA No data
Right 1012119024 6:95340138-95340160 GGCTGCTGAACCAGGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119019 Original CRISPR TGAGCTCCCAGACCCTTCCT GGG (reversed) Intergenic
No off target data available for this crispr