ID: 1012119023

View in Genome Browser
Species Human (GRCh38)
Location 6:95340137-95340159
Sequence AGGCTGCTGAACCAGGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119013_1012119023 17 Left 1012119013 6:95340097-95340119 CCTGCATCATAGTCTTTGCCCAG No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data
1012119019_1012119023 -1 Left 1012119019 6:95340115-95340137 CCCAGGAAGGGTCTGGGAGCTCA No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data
1012119020_1012119023 -2 Left 1012119020 6:95340116-95340138 CCAGGAAGGGTCTGGGAGCTCAG No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data
1012119012_1012119023 18 Left 1012119012 6:95340096-95340118 CCCTGCATCATAGTCTTTGCCCA No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data
1012119011_1012119023 21 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119023 Original CRISPR AGGCTGCTGAACCAGGCAAG TGG Intergenic
No off target data available for this crispr