ID: 1012122016

View in Genome Browser
Species Human (GRCh38)
Location 6:95380664-95380686
Sequence ATGAGTTCATGTCCTCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37727
Summary {0: 3, 1: 162, 2: 5765, 3: 22160, 4: 9637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012122012_1012122016 7 Left 1012122012 6:95380634-95380656 CCATGGAATACTATGCAGCTATA 0: 436
1: 25124
2: 14091
3: 8335
4: 5529
Right 1012122016 6:95380664-95380686 ATGAGTTCATGTCCTCTGCGGGG 0: 3
1: 162
2: 5765
3: 22160
4: 9637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012122016 Original CRISPR ATGAGTTCATGTCCTCTGCG GGG Intergenic
Too many off-targets to display for this crispr