ID: 1012123819

View in Genome Browser
Species Human (GRCh38)
Location 6:95400869-95400891
Sequence CAACAGCAGCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012123819_1012123822 -10 Left 1012123819 6:95400869-95400891 CCCTTCTCCATCTGCTGCTGTTG No data
Right 1012123822 6:95400882-95400904 GCTGCTGTTGCTACAATTTTAGG No data
1012123819_1012123823 -4 Left 1012123819 6:95400869-95400891 CCCTTCTCCATCTGCTGCTGTTG No data
Right 1012123823 6:95400888-95400910 GTTGCTACAATTTTAGGTTGTGG No data
1012123819_1012123825 28 Left 1012123819 6:95400869-95400891 CCCTTCTCCATCTGCTGCTGTTG No data
Right 1012123825 6:95400920-95400942 CCATATAAATTTTCACCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012123819 Original CRISPR CAACAGCAGCAGATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr