ID: 1012128981

View in Genome Browser
Species Human (GRCh38)
Location 6:95467142-95467164
Sequence AGAATCAGTCCTGTGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012128981_1012128985 2 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128985 6:95467167-95467189 CTCACTGTCCCTTCAGTCCAGGG No data
1012128981_1012128989 10 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128989 6:95467175-95467197 CCCTTCAGTCCAGGGCACCGGGG No data
1012128981_1012128994 29 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128994 6:95467194-95467216 GGGGATCAGGAGCCCTGACCTGG No data
1012128981_1012128984 1 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128984 6:95467166-95467188 ACTCACTGTCCCTTCAGTCCAGG No data
1012128981_1012128995 30 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128995 6:95467195-95467217 GGGATCAGGAGCCCTGACCTGGG No data
1012128981_1012128991 16 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128991 6:95467181-95467203 AGTCCAGGGCACCGGGGATCAGG No data
1012128981_1012128986 8 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128986 6:95467173-95467195 GTCCCTTCAGTCCAGGGCACCGG No data
1012128981_1012128987 9 Left 1012128981 6:95467142-95467164 CCTCCCTACACAGGACTGATTCT No data
Right 1012128987 6:95467174-95467196 TCCCTTCAGTCCAGGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012128981 Original CRISPR AGAATCAGTCCTGTGTAGGG AGG (reversed) Intergenic