ID: 1012138847

View in Genome Browser
Species Human (GRCh38)
Location 6:95595161-95595183
Sequence TATTTTATGCAGAAAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 714}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012138847_1012138848 -10 Left 1012138847 6:95595161-95595183 CCTTTCATTTTCTGCATAAAATA 0: 1
1: 0
2: 6
3: 67
4: 714
Right 1012138848 6:95595174-95595196 GCATAAAATAATTTTTTCGTAGG 0: 1
1: 0
2: 1
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012138847 Original CRISPR TATTTTATGCAGAAAATGAA AGG (reversed) Intronic
901515351 1:9741593-9741615 ATTTTTATTCAGAAAAGGAATGG - Intronic
903108442 1:21106253-21106275 TATTTTTTATAAAAAATGAATGG - Intronic
903376294 1:22868339-22868361 AATGTCATGCAGCAAATGAACGG - Intronic
904448116 1:30590949-30590971 AATTTGATGAACAAAATGAAAGG + Intergenic
905007322 1:34720369-34720391 GATTTTATGCTGAAAGTGAAAGG + Intronic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
906973428 1:50543764-50543786 TTTTCCATTCAGAAAATGAATGG + Intronic
907062336 1:51442515-51442537 TATTTTATGTAGCATTTGAAGGG + Intronic
907651430 1:56298659-56298681 AATTTTATCCAGAAAAAGAGGGG + Intergenic
907822068 1:57979927-57979949 TATTTTATGAACAAAAAGAAAGG + Intronic
907952312 1:59195673-59195695 TATATTAGTCAAAAAATGAAAGG - Intergenic
908679103 1:66639802-66639824 GATTTTATGCGGAAATTGATTGG + Exonic
909045430 1:70703908-70703930 TATCTTATGAGGAAAATAAATGG - Intergenic
909089632 1:71209108-71209130 CATTTTATTCAAAGAATGAAGGG - Intergenic
909209055 1:72799279-72799301 TATTTTATGCAACAAATGAAGGG + Intergenic
909294038 1:73922986-73923008 CATTTTATCCAGACAATGCATGG + Intergenic
909295436 1:73941844-73941866 GAGTTTATGCAGAAAAGGAATGG - Intergenic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
909960411 1:81833703-81833725 TATTTAATGCAGCTAATAAATGG + Intronic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
911626171 1:100127122-100127144 TATATAATTCAGAAAATAAAGGG + Intronic
911662340 1:100515708-100515730 TATTTTAGATTGAAAATGAAAGG + Intronic
911754134 1:101532976-101532998 TATTTCAGGCAGAATATGACAGG + Intergenic
912488033 1:110044595-110044617 TAGTTTATTCATAAAATTAAAGG - Intronic
912722767 1:112034036-112034058 TATTTTATGCAGACCTTCAATGG + Intergenic
912907793 1:113724934-113724956 TATTTTTGGCAGAAATAGAAAGG - Intronic
913372893 1:118120466-118120488 TATTTTATGCCCAAACTGAAAGG + Intronic
913703083 1:121392939-121392961 AATATTAGGTAGAAAATGAAGGG + Intergenic
913720729 1:121591061-121591083 AATTTCTTCCAGAAAATGAAAGG + Intergenic
913939820 1:125090994-125091016 AATATTAGGTAGAAAATGAAGGG - Intergenic
914043645 1:144073437-144073459 AATATTAGGTAGAAAATGAAGGG + Intergenic
914134442 1:144887054-144887076 AATATTAGGTAGAAAATGAAGGG - Intergenic
914742325 1:150475299-150475321 TTTTTTTTGCAGAAATTAAATGG + Intronic
915906914 1:159885571-159885593 CCTTTTCTGCACAAAATGAAGGG + Intronic
916146835 1:161747591-161747613 TATTTTATCCAAAAAATTGAGGG + Intergenic
916499255 1:165372872-165372894 TATTCTTTGCAAAAAATAAATGG - Intergenic
916612235 1:166403809-166403831 TATTCTGTGCAGAAAGTCAATGG + Intergenic
916911809 1:169357541-169357563 GTTTTTATGCAAAGAATGAATGG - Intronic
917277862 1:173350020-173350042 TATTTATTGTAGAAAATAAATGG + Intergenic
917300890 1:173572980-173573002 GATTTTATCCATAAAATGAGAGG - Intronic
917333259 1:173904228-173904250 TCTTTCATGCAGAGAATGTAAGG + Intronic
917417848 1:174829843-174829865 GAATTTATGAAGAAAATAAATGG - Intronic
918599622 1:186340758-186340780 TATTTTAGAGATAAAATGAAAGG + Intronic
918731066 1:187997294-187997316 TATTTGTAGCAGAAATTGAATGG - Intergenic
918905022 1:190479895-190479917 TTTTTGATGCACAAAATTAAGGG + Intergenic
918948486 1:191102573-191102595 TAATCTATGCAGAACAAGAAAGG - Intergenic
919463558 1:197906583-197906605 TATTATAAGCAAAAAATAAATGG + Intronic
919816113 1:201440759-201440781 ATTTTTATGAAGACAATGAATGG - Intergenic
920070411 1:203298577-203298599 TTTTTAAAGCAGAAAAAGAAGGG + Intergenic
920286818 1:204885588-204885610 TGTTTTATGAAGAAAGTGACTGG + Intronic
921394075 1:214650265-214650287 TATTTTTTTTAGAAATTGAAAGG + Intronic
921886713 1:220314435-220314457 TATGTTATGCTGATAATAAAGGG - Intergenic
921919072 1:220645855-220645877 TAGTTTATTGAGAACATGAAGGG - Intronic
923031323 1:230251137-230251159 TCTTTTATGCAGTAAATATAAGG - Intronic
923169677 1:231403204-231403226 TATTTTATGCTGTTAATGCAAGG + Intronic
923423578 1:233845144-233845166 CATGTTATGAAGAAACTGAAAGG + Intergenic
923645208 1:235813638-235813660 TATTTTATGGACCAAATGAGGGG - Intronic
924062382 1:240188426-240188448 TTTTGTATGCAAAAAATAAATGG - Intronic
924381460 1:243469023-243469045 GATTTTATAGAGCAAATGAAAGG + Intronic
924712508 1:246541730-246541752 TATTTTTTGCAGAAAGGAAAAGG - Intronic
924791732 1:247256792-247256814 TATTTTATACAGACAATAAGAGG + Intergenic
1063296100 10:4808249-4808271 TGGTTTATTCTGAAAATGAAAGG - Intronic
1063345000 10:5303388-5303410 TCTTTGATGGAGAAGATGAAAGG + Intergenic
1063833910 10:9989864-9989886 TATTTGATTCAGATAATTAATGG + Intergenic
1064395289 10:14976775-14976797 AATATTATGAAGAATATGAAAGG - Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1066173550 10:32878955-32878977 TATTTTATTCATAAAATGTATGG + Intronic
1068316082 10:55344357-55344379 TATTTTATGAATAAAATTCATGG + Intronic
1068338648 10:55671655-55671677 TATTTTATTAATTAAATGAATGG - Intergenic
1068463642 10:57358518-57358540 GATTTTCTCCAGAAAATGACTGG - Intergenic
1068869379 10:61927154-61927176 TCTCTTGAGCAGAAAATGAAGGG - Intronic
1069103221 10:64350292-64350314 TATTATAAGTAGAAAATAAATGG + Intergenic
1069126865 10:64646052-64646074 TATTTTTTCCAGGAAATGAGAGG + Intergenic
1069483085 10:68801691-68801713 TATTTAAGAAAGAAAATGAATGG - Intergenic
1069626641 10:69872048-69872070 TATTTTATGAACAAAACGAAGGG - Intronic
1069876181 10:71564428-71564450 TAAGTTATGCAGAAATTAAATGG + Intronic
1070490649 10:76972907-76972929 TTCTTTATGCAGAAATTGATAGG - Intronic
1071320860 10:84455580-84455602 TATTTTATGCAGAAAGAAAGTGG - Intronic
1071734018 10:88278079-88278101 GATTTTAGGCACATAATGAATGG + Intronic
1071901187 10:90121641-90121663 AATTTAATACAGAAAATGAAAGG + Intergenic
1071974256 10:90939432-90939454 TATTTTATGCAAAAAACACAGGG - Intergenic
1072908252 10:99475501-99475523 TATTTTGTTCAGACAATAAATGG - Intergenic
1073061970 10:100738576-100738598 TAATTGATTCAGAAATTGAAAGG + Intronic
1073220749 10:101871332-101871354 AATTTTATACAGAAATGGAAAGG + Intronic
1073344773 10:102774753-102774775 AAATTGTTGCAGAAAATGAAAGG + Intronic
1073581507 10:104670698-104670720 TGTTTTTTGCAGAAATAGAAAGG - Intronic
1073714476 10:106087257-106087279 TTTTTTAAGCAGGAAAGGAAAGG - Intergenic
1073857521 10:107694649-107694671 AATTTTTTTAAGAAAATGAAAGG - Intergenic
1074180194 10:111055026-111055048 AATTTAATGGAGAAAAAGAATGG - Intergenic
1074293191 10:112157057-112157079 CATTTTAAGTAGAAAAGGAAAGG - Intronic
1074469855 10:113716937-113716959 TATGTTATGTAAAAAATAAAAGG - Intronic
1074656184 10:115590597-115590619 TATTTTATATACAAAAGGAAGGG - Intronic
1075443784 10:122499759-122499781 TATTTTTTAAAGAAAATGAAAGG + Intronic
1075794570 10:125109926-125109948 TACTTTATGGAGAAAAGGAAGGG + Intronic
1075978223 10:126715332-126715354 TATTTTATACTGCAAATTAAGGG - Intergenic
1076170753 10:128317891-128317913 TCTTTTATAAATAAAATGAATGG + Intergenic
1076277978 10:129221347-129221369 TAATTTATAAAGAAAAAGAAAGG + Intergenic
1076591741 10:131588276-131588298 TGTTTTGTGCAGAAAATGCTTGG + Intergenic
1076712946 10:132348825-132348847 TCAGTTATGCAGAAAATAAATGG + Intronic
1077817590 11:5701242-5701264 AATTTGTTTCAGAAAATGAAAGG - Intronic
1078139976 11:8685135-8685157 TATTATCTGGAGAACATGAAGGG - Intronic
1078163030 11:8858357-8858379 AATTTTAGGAAGAAAAAGAAAGG + Intronic
1078320128 11:10327021-10327043 TGTTTTAGGCTGAAAGTGAAGGG + Intronic
1078392461 11:10947790-10947812 AATTCTATGCAGAAAGTCAATGG + Intergenic
1078713508 11:13817487-13817509 AATTTTATAAAGAAAATTAAAGG - Intergenic
1079390064 11:20014444-20014466 TCTTTTAAACAGAAAATTAAAGG - Intronic
1079820913 11:25127089-25127111 TAATTTATTTAGAAAATAAAGGG + Intergenic
1080258936 11:30324246-30324268 TGTTTTATGAAAAAAATTAAAGG - Intronic
1080355275 11:31436807-31436829 TATTTTAAGTATCAAATGAAAGG - Intronic
1080929186 11:36789730-36789752 TATTTTATGGAGGAATGGAAAGG + Intergenic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1081382871 11:42437262-42437284 GATTTTATGCAGAACCAGAATGG - Intergenic
1082163039 11:48905061-48905083 TATTTCATGCAGAACATTAGGGG - Intergenic
1082211936 11:49515923-49515945 TATTTTGTGCAGAGAATCAGAGG - Intergenic
1082238371 11:49847665-49847687 TATTTCATGCAGAACATTAGGGG + Intergenic
1082664232 11:55954110-55954132 TATTTTTTGGAGAAGATAAAAGG + Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1084024433 11:66438957-66438979 TGTTTTATGCAGATAAAGGAAGG + Intronic
1084149522 11:67281656-67281678 TATGACATGCAGACAATGAATGG - Exonic
1084766786 11:71315142-71315164 GATTTTATGCAGAAAATTACAGG - Intergenic
1084996676 11:72986544-72986566 TATTTTATCTAGAAAAGTAAAGG + Intronic
1085099969 11:73792279-73792301 TATTTTGCACAGAAAATGAATGG + Intronic
1085357352 11:75850634-75850656 TATTGTATGCAGATAATTAGTGG + Intronic
1085500120 11:77013298-77013320 TATAGTATTCAGAAAATAAAAGG + Intronic
1085889558 11:80561692-80561714 TATTTAATGAGTAAAATGAACGG + Intergenic
1085913712 11:80859325-80859347 TATTTAATACAATAAATGAAGGG - Intergenic
1086126103 11:83350192-83350214 TTTCTTATGAAGAATATGAAAGG - Intergenic
1086159356 11:83704027-83704049 TATAGGATGCAGAAAATAAATGG + Intronic
1086343117 11:85867527-85867549 TATTTCAAGTAGAAAATAAAAGG - Intronic
1086358685 11:86034280-86034302 TACTGTATGGAGAAAATGACTGG - Intronic
1086515876 11:87612816-87612838 TATTTTTGGAAGAAAAAGAAAGG + Intergenic
1086527357 11:87743660-87743682 AATTTCATTCAGAAAATTAAAGG + Intergenic
1086637645 11:89108592-89108614 TATTTTGTGCAGAGAATCAGAGG + Intergenic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1086698210 11:89868484-89868506 TATTTCATGCAGAACATTAGGGG - Intergenic
1086707954 11:89976004-89976026 TATTTCATGCAGAACATTAGGGG + Intergenic
1086943540 11:92822439-92822461 CATTTTCTGCAGAAAATCCAAGG + Intronic
1087270937 11:96111011-96111033 TCTTTGATGGAGAAAATGATAGG - Intronic
1087975472 11:104540662-104540684 TTCTTTATTCAGAAAATAAATGG - Intergenic
1088243026 11:107790393-107790415 AATTGGTTGCAGAAAATGAAAGG + Intergenic
1088397075 11:109380813-109380835 GCAGTTATGCAGAAAATGAAAGG + Intergenic
1088448526 11:109957978-109958000 TGATTTATGCAGTAAATTAAGGG + Intergenic
1088553076 11:111034374-111034396 TCTGTGCTGCAGAAAATGAATGG + Intergenic
1089220342 11:116865746-116865768 CATTTCCTCCAGAAAATGAAAGG + Intronic
1089234475 11:117011494-117011516 TATTTTCTACAGAAATTAAACGG + Intronic
1089288505 11:117422890-117422912 TAATTTATGCAGGAGATGAAGGG - Intergenic
1089598186 11:119595796-119595818 TTTTTTATGCAGAAAGGCAAAGG + Intergenic
1090168149 11:124573576-124573598 TATTTAAAACAGAAAATCAACGG + Intergenic
1090626142 11:128610622-128610644 TAATTCATGCTGAAAATGCAAGG + Intergenic
1091097702 11:132839687-132839709 TATTTTATTCAGAGAGTGAGAGG - Intronic
1091099706 11:132859921-132859943 AATTGAAAGCAGAAAATGAAAGG - Intronic
1091117070 11:133023225-133023247 TATTTTAAGCAGATAATTACAGG - Intronic
1091533456 12:1383064-1383086 GATTTGATGCTGGAAATGAAGGG - Intronic
1092443695 12:8533315-8533337 AATTTTATGCAATAAATGAATGG + Exonic
1092763275 12:11828843-11828865 AAATTAATGCAGAAAATGTATGG - Intronic
1092932300 12:13327592-13327614 CATTTTCTGCATAAAAAGAATGG - Intergenic
1093418684 12:18949727-18949749 TATTTTATTCATAAAATAAATGG - Intergenic
1093515885 12:19986624-19986646 TATTTTGTGCAGAAAATACTGGG - Intergenic
1093739550 12:22667585-22667607 TATTTTATACAGAAAAAGACAGG - Intronic
1093891462 12:24526531-24526553 TATTTCTTCCAGAAAATGAAAGG - Intergenic
1094358539 12:29604884-29604906 TTTTTTATTCAAAAAATCAATGG - Intronic
1095145486 12:38721541-38721563 TGAGGTATGCAGAAAATGAAGGG - Intronic
1095170990 12:39036260-39036282 AATTTTATGTACAAACTGAAAGG - Intergenic
1095326571 12:40901711-40901733 TATTTTATTCTGACAATGGAAGG + Intronic
1095468716 12:42514286-42514308 TATGAAATGCAGAAAATAAAAGG - Intronic
1095492991 12:42755835-42755857 TCCTTTAAACAGAAAATGAAAGG - Intergenic
1095582489 12:43816075-43816097 TATTTTGTGCACAAATTGTAAGG + Intergenic
1095724013 12:45432698-45432720 TATTTTAAAAAGGAAATGAATGG - Intronic
1097606343 12:61759105-61759127 TATTATATGTTGAAAAAGAAAGG + Intronic
1097822024 12:64137537-64137559 TATTTTATTAAGCAAATTAATGG + Intronic
1098040316 12:66347732-66347754 TTTTTTTTGCACAAAAAGAAAGG + Exonic
1098047853 12:66420428-66420450 TTTTTTGGTCAGAAAATGAATGG + Intronic
1098298081 12:69024473-69024495 AATTGTAGGCTGAAAATGAAGGG + Intergenic
1098656493 12:73037377-73037399 TTTATTATGCAGAACATGAGAGG + Intergenic
1098796988 12:74901719-74901741 TATTTTTTGAACAAAATGACTGG + Intergenic
1099612617 12:84893603-84893625 TATTTTATTCCAGAAATGAAGGG - Intronic
1099639360 12:85265885-85265907 TGTTTTATGCAGAAAATAATTGG + Intergenic
1099684653 12:85869205-85869227 TGTTTTAAGCAGAGAATGACAGG + Intergenic
1099713216 12:86256023-86256045 AATTTGCAGCAGAAAATGAAAGG - Intronic
1099760066 12:86909564-86909586 TACTCTTTGAAGAAAATGAAAGG + Intergenic
1100038688 12:90283911-90283933 TATTTTCTACAGAAATTGAATGG - Intergenic
1100088956 12:90946879-90946901 TATTTTCTGTATAAAAAGAAGGG + Intronic
1100533725 12:95485320-95485342 TAATTTATGCACAATATAAAAGG + Intronic
1101171100 12:102094822-102094844 TGTTTTATAGAGAAAGTGAATGG + Intronic
1101215126 12:102573721-102573743 TGTTGTATGAAGCAAATGAAAGG + Intergenic
1101699257 12:107156352-107156374 TATTGGATGCAGAGTATGAAAGG + Intergenic
1103545338 12:121697036-121697058 TCTTTTGTGCATAAAATGTACGG - Intergenic
1105461228 13:20590113-20590135 TGTATCATGTAGAAAATGAAAGG - Intronic
1105512678 13:21063444-21063466 TATTTTATGCACAAATTTTAAGG - Intergenic
1105757112 13:23476743-23476765 TTTTTTTTGCAGAAATTGACAGG - Intergenic
1106778594 13:33032746-33032768 TATTTTTTACAGAAAATAGATGG - Intronic
1106854528 13:33835103-33835125 TATTTTGTGAAGAAAATAAGAGG - Intronic
1106992718 13:35441415-35441437 TACATTATGCCAAAAATGAATGG - Intronic
1107213853 13:37891927-37891949 TATTTAATGAAGAACATGGATGG + Intergenic
1108164466 13:47677630-47677652 TCTTTGATGCAGGAAATGAGTGG + Intergenic
1108830251 13:54468853-54468875 TATTATATGATGAAGATGAAGGG + Intergenic
1108953615 13:56122030-56122052 GTTTTTATTCATAAAATGAAAGG + Intergenic
1109531955 13:63661595-63661617 TATTATAAGTAGAAAATGCATGG - Intergenic
1109729240 13:66389124-66389146 TATTTTATGAATAAAATCATTGG + Intronic
1109760503 13:66821575-66821597 TATTTCTTCCAGAAAATAAATGG - Intronic
1109770771 13:66969555-66969577 TGTTTTATGCAGAAAGTGCTGGG - Intronic
1109812283 13:67529314-67529336 CATTTTGGGCAGAAAATTAATGG + Intergenic
1109937172 13:69302726-69302748 GATTTTATGAAGAAAATCAAAGG - Intergenic
1110092058 13:71464622-71464644 TATTTTATGAAGACAATTAAGGG + Intronic
1110271714 13:73598747-73598769 TATTTTATGTAAAAAATAGAGGG - Intergenic
1110374193 13:74774000-74774022 TATAGTATGAAGAATATGAAGGG + Intergenic
1110989129 13:82014669-82014691 TATTTTATGCATAAATAGAGAGG + Intergenic
1111032004 13:82612735-82612757 TAATTAATGCAAAAAATTAAGGG - Intergenic
1111033906 13:82644785-82644807 TTTTTTAAGCAGAAAATATAAGG - Intergenic
1111537437 13:89621540-89621562 TTTTTTATGCAGAAAGTTATTGG - Intergenic
1111774010 13:92636252-92636274 TATTTTATGCAATAAATGTTTGG - Intronic
1111859094 13:93678878-93678900 TTTTGTCTGCAGAAAAAGAAGGG + Intronic
1111878765 13:93929323-93929345 TATTTTTGGCATAAAATGTATGG - Intronic
1112421605 13:99255612-99255634 TTTATTATGCAAAAGATGAATGG - Exonic
1112926493 13:104681542-104681564 TATAATATGTAGAAAATAAAGGG - Intergenic
1113255711 13:108502259-108502281 AATTTTAAGAAAAAAATGAAGGG + Intergenic
1114894747 14:26973556-26973578 TGTTATATGCAGAAAAAGATAGG - Intergenic
1115292560 14:31788931-31788953 TTTTTTAGGCAGAACATGACTGG + Intronic
1115343843 14:32321142-32321164 TATTTTAGGCAGTAAAGGAAGGG + Intergenic
1115485516 14:33907811-33907833 TAGTCTATTCAGACAATGAAAGG + Intergenic
1116098101 14:40398239-40398261 TATTTGTTACAGAAAATAAAGGG + Intergenic
1116251747 14:42493361-42493383 TATTTTATATGAAAAATGAATGG - Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1116787699 14:49306074-49306096 TCTTTGATGCAGATAATCAAAGG + Intergenic
1117318047 14:54593139-54593161 TATATTATCCAAACAATGAATGG - Intronic
1117469935 14:56033302-56033324 TAATCATTGCAGAAAATGAAGGG - Intergenic
1117786924 14:59295699-59295721 TACTTTGTGTAGAAAATGGATGG - Intronic
1118169200 14:63369449-63369471 AATTTTATGCAGAAATGCAAAGG + Intergenic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1119068703 14:71558372-71558394 GATGTTATCCAGAAAATTAATGG - Intronic
1120601797 14:86520079-86520101 TATGTTATACATGAAATGAAAGG - Intergenic
1120794172 14:88613732-88613754 CATTTTATACATAAAATGAATGG + Exonic
1120926132 14:89799210-89799232 CATTTTATTCACATAATGAATGG + Intronic
1121961563 14:98264890-98264912 TGTTTTCTCCAGTAAATGAAAGG - Intergenic
1122103463 14:99432283-99432305 TATTCAATTCAGAAAATAAATGG - Intronic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1123173505 14:106396754-106396776 TATACTATGCAGACACTGAAGGG - Intergenic
1202935033 14_KI270725v1_random:79990-80012 AAATGTTTGCAGAAAATGAATGG + Intergenic
1202936936 14_KI270725v1_random:97307-97329 AATATTAGGTAGAAAATGAAGGG - Intergenic
1123392940 15:19895891-19895913 AATATTAGGTAGAAAATGAAGGG + Intergenic
1123961989 15:25412678-25412700 TATGTAATGCAGTACATGAAAGG - Intronic
1124105449 15:26733609-26733631 TGTTTTATGCAGAAAAAGAAAGG + Intronic
1124733386 15:32220052-32220074 TATTATAGGTTGAAAATGAAAGG - Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125215053 15:37262615-37262637 TATATTTTGGAGAAAATGCATGG - Intergenic
1125418271 15:39476020-39476042 TATTTTATGAAGAATAGGCAGGG + Intergenic
1126054553 15:44717688-44717710 CACTTTATGCACAAAATGTAGGG + Exonic
1126156627 15:45571431-45571453 TATTTGATGTAGTAGATGAAAGG - Intergenic
1126400753 15:48267354-48267376 TGTTTTGGGTAGAAAATGAATGG + Intronic
1126864155 15:52919585-52919607 GTTTTGATACAGAAAATGAATGG - Intergenic
1127024627 15:54790243-54790265 TATTTTCTCCATAAACTGAAAGG + Intergenic
1129611704 15:77065201-77065223 TGTGTTATGCAGAGAATTAAAGG - Intronic
1129700658 15:77766390-77766412 TTTTTTTTGCGGAAAATGATAGG - Intronic
1130829093 15:87581442-87581464 TATTTTATTCTGAAAATGGCTGG - Intergenic
1131917378 15:97283585-97283607 TATTTTAAGCAGATAGAGAAAGG - Intergenic
1132319142 15:100912660-100912682 TGTGTTAGGCAGAAAATGAATGG - Intronic
1132941706 16:2511776-2511798 GAACTTAGGCAGAAAATGAATGG + Intronic
1134115819 16:11547693-11547715 TGTTTTGTTCAGAGAATGAATGG + Intergenic
1134482637 16:14632561-14632583 CATTTTATGTAGAAAATCACAGG - Intronic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135300980 16:21326951-21326973 TTTTTTGTGCAAAAAATGAGTGG + Intergenic
1135637293 16:24089125-24089147 TATTCTATGGGGAAAATGCATGG + Intronic
1136698739 16:32112603-32112625 AATATTAGGTAGAAAATGAAGGG + Intergenic
1136768864 16:32815226-32815248 AATATTAGGTAGAAAATGAAGGG - Intergenic
1136799244 16:33055902-33055924 AATATTAGGTAGAAAATGAAGGG + Intergenic
1136901728 16:34047126-34047148 AATATTAGGTAGAAAATGAAGGG + Intergenic
1136956922 16:34798851-34798873 AATATTAGGTAGAAAATGAAGGG + Intergenic
1138950144 16:61902860-61902882 CATTTTATACAATAAATGAAAGG - Intronic
1138971460 16:62149342-62149364 CATTTTAAGAAGAGAATGAAAGG + Intergenic
1138985952 16:62328707-62328729 TGTTATAGGCAGAACATGAAAGG - Intergenic
1139127244 16:64093380-64093402 TAGTATATGGAAAAAATGAACGG + Intergenic
1139134568 16:64186376-64186398 AATCTTTTGCAGAAAATGGATGG - Intergenic
1139869181 16:70090476-70090498 GATTTTATACAGAGGATGAAAGG + Intergenic
1140379587 16:74474308-74474330 TAATTTATGAAGAAAACCAAAGG + Intronic
1140386201 16:74541661-74541683 GATTTTATACAGAGAATGAAAGG - Intronic
1140588693 16:76325085-76325107 TATTTGGTGCAGAAAATGTCAGG - Intronic
1142021237 16:87783994-87784016 TTCTTTACCCAGAAAATGAAAGG + Intergenic
1203071281 16_KI270728v1_random:1077337-1077359 AATATTAGGTAGAAAATGAAGGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1144436004 17:15241561-15241583 TAGTTTCTGCTGAAAATGACAGG - Intronic
1145191984 17:20850856-20850878 TATTGTTTGCAAAAAATCAAGGG + Intronic
1145402203 17:22550893-22550915 TATTGTTTGCAAAAAATCAAGGG + Intergenic
1145709625 17:26959478-26959500 AATATTAGGTAGAAAATGAAGGG + Intergenic
1146544271 17:33724878-33724900 TTTTTTAAGAAAAAAATGAACGG - Intronic
1146603996 17:34242491-34242513 TTTGTTTTGCAGAAAATGGAAGG + Intergenic
1147388981 17:40097932-40097954 TATTCTCTGAAGGAAATGAAGGG + Intronic
1149095996 17:52841710-52841732 TATTTTATGCAGAAAAAACTTGG - Intergenic
1149417507 17:56475092-56475114 TATTTTATACAGAAAAGTACTGG + Intronic
1149543537 17:57486525-57486547 TATTATTTGCATAAAACGAAAGG - Intronic
1154394600 18:13975585-13975607 TGTTTTAGGCAGAGAATAAATGG - Intergenic
1154435589 18:14339280-14339302 AAATTTAGGCAGAAAATCAAGGG - Intergenic
1154518640 18:15201270-15201292 AATATTAGGTAGAAAATGAAGGG - Intergenic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1155307712 18:24495429-24495451 AATTTCATGAAGAAAACGAAGGG + Intergenic
1155821967 18:30389102-30389124 TGTTTTATGGAAGAAATGAAGGG + Intergenic
1155859464 18:30878766-30878788 TTTCTAATGCAGAAGATGAAGGG - Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1155925635 18:31652304-31652326 AATTTGGTGCAGAAAACGAATGG - Intronic
1156325654 18:36072475-36072497 TATTTTATGAACTAAATTAAAGG + Intergenic
1156534703 18:37851180-37851202 TTTTTTTTGTAGCAAATGAATGG + Intergenic
1158322513 18:56279155-56279177 TATTTTATGAAAAGAAGGAAGGG - Intergenic
1158507005 18:58055671-58055693 TATTTTAAGGAAAAAATGACTGG + Intronic
1159447795 18:68561361-68561383 TATTTTATGCATAACAAAAAGGG - Intergenic
1159660516 18:71090409-71090431 AATTCTATGAAGAAAATCAATGG + Intergenic
1161136917 19:2625386-2625408 TATTTTTTGCAGAAATAGAGGGG + Intronic
1162257138 19:9499620-9499642 TATTCTGTGCAGAAAAAGAAAGG + Intergenic
1163229200 19:15988500-15988522 TATTTCCTGGAGAAAAGGAAGGG + Intergenic
1164421520 19:28097662-28097684 TATTTTATTAAAAACATGAATGG - Intergenic
1164567880 19:29341056-29341078 GATTTTAAGGAGAAAATGAAGGG - Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1167803714 19:51764152-51764174 TGTTTTTGGCAGAAAATGGAAGG + Intronic
1168556724 19:57349196-57349218 TATTTTATACAGATAATGAGTGG + Intergenic
1168633324 19:57974450-57974472 TATTTTATCCCGTAGATGAAAGG + Exonic
1202682885 1_KI270712v1_random:25768-25790 AATATTAGGTAGAAAATGAAGGG + Intergenic
924971318 2:130083-130105 CCTTTTATCAAGAAAATGAAAGG + Intergenic
924975443 2:169976-169998 TATTGTATTCATAAAATGAAGGG + Intergenic
925211835 2:2056078-2056100 AATTTTGTGGACAAAATGAAAGG + Intronic
925600299 2:5602102-5602124 TAATGTATGCAGAAAAAGAAAGG - Intergenic
926340137 2:11898602-11898624 TATTTTGTGCAGAAGCAGAAAGG + Intergenic
926654532 2:15386691-15386713 TAGTTTATGCATAAAATAAAGGG - Intronic
926993356 2:18704766-18704788 TATTCTATGCAGAATGTAAATGG + Intergenic
927353037 2:22141097-22141119 TATTTTAGGAAGATAATCAAGGG - Intergenic
928219113 2:29388247-29388269 TATTTTAAGCCCAGAATGAAGGG + Intronic
928954815 2:36853730-36853752 TATTTTTTTAAAAAAATGAAAGG - Intronic
929079269 2:38106387-38106409 TATTTTAGGCAGAAAAGCACAGG - Intronic
929322412 2:40560447-40560469 TATTTTATGTTATAAATGAATGG + Intronic
930992905 2:57682054-57682076 TATTTGAGGGAGAAAAGGAAGGG - Intergenic
931384870 2:61789362-61789384 TATTTTATTCATAAAATGAAGGG + Intergenic
931956028 2:67426216-67426238 TGTTTTATGAGGAAAAAGAAGGG - Intergenic
931968875 2:67564371-67564393 TATTTTCTCCAGAAAATGAAAGG + Intergenic
932294393 2:70612427-70612449 TTGTTTATGCAAAAAAAGAAAGG - Intronic
932452420 2:71821014-71821036 TAGTTTATGCAAAAAAGAAATGG + Intergenic
932566256 2:72912310-72912332 TATCTTGTTCAGAAAATAAAGGG + Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
932914306 2:75838585-75838607 AATTCTATGAAGAAAATCAATGG - Intergenic
933114496 2:78450535-78450557 TAAATGATGAAGAAAATGAAAGG + Intergenic
933395008 2:81719869-81719891 TATCTAGTGAAGAAAATGAAAGG + Intergenic
933917995 2:87016077-87016099 TTTTTTGTTCAAAAAATGAAAGG - Intronic
934005000 2:87753837-87753859 TTTTTTGTTCAAAAAATGAAAGG + Intronic
934189276 2:89771007-89771029 AATATTAGGTAGAAAATGAAGGG - Intergenic
934248912 2:90329406-90329428 AATATTAGGTAGAAAATGAAGGG - Intergenic
934260667 2:91474074-91474096 AATATTAGGTAGAAAATGAAGGG + Intergenic
934303984 2:91806021-91806043 AATATTAGGTAGAAAATGAAGGG + Intergenic
934329270 2:92046729-92046751 AATATTAGGTAGAAAATGAAGGG - Intergenic
934467488 2:94276651-94276673 AATATTAGGTAGAAAATGAAGGG - Intergenic
934588021 2:95522227-95522249 TATTTCATGCAGAACATTAGGGG + Intergenic
935194579 2:100804887-100804909 CATTTTATGAAAAAAATAAAAGG + Intergenic
935567541 2:104625258-104625280 AATTCTATGAAGAAAATCAATGG + Intergenic
935774807 2:106463746-106463768 TGTTTTAAGCTGAAATTGAACGG + Intronic
935808707 2:106774102-106774124 GATTTTAGGCAGAAAAGGAGAGG + Intergenic
935847467 2:107182256-107182278 TACTTTAGGTTGAAAATGAAAGG - Intergenic
935905261 2:107832166-107832188 TGTTTTAAGCTGAAATTGAACGG - Intronic
936394721 2:112115934-112115956 TATTACATACAGAAAATAAAAGG - Intronic
936797129 2:116220171-116220193 TATATCATGCAGAAAATAAGAGG - Intergenic
937698725 2:124839265-124839287 TATTTTATACAGAGTATAAAAGG + Intronic
937769433 2:125702524-125702546 CATATTTTGCAGAAAAAGAAAGG - Intergenic
937821299 2:126313904-126313926 CACTTTAGGCAGAAAATGAGAGG + Intergenic
938050082 2:128161626-128161648 TATTTTGTTCAGGAAAGGAAAGG + Intronic
938186784 2:129239148-129239170 CATTTTGTGCATAAAATGTAAGG + Intergenic
938439338 2:131313610-131313632 TATTTTGTGAGGAAAATAAAAGG - Intronic
938572692 2:132575255-132575277 TATTTTAAGCATAAAATCAATGG - Intronic
938646463 2:133335878-133335900 AATTTTATAAACAAAATGAATGG + Intronic
938702728 2:133893653-133893675 TGTCTTAGGCAGACAATGAACGG - Intergenic
940105802 2:150098658-150098680 TATCTTGTGCAGAAACTAAAAGG - Intergenic
940506157 2:154556032-154556054 AATTGCATCCAGAAAATGAAAGG - Intergenic
941174349 2:162178640-162178662 TATGTGAGCCAGAAAATGAAAGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941543223 2:166813240-166813262 AATACTATTCAGAAAATGAACGG - Intergenic
941595291 2:167468975-167468997 TATTTTATTCAGTAAATACATGG - Intergenic
941739375 2:169016631-169016653 TATTTTAAAGAGAAAAAGAATGG + Intronic
941976891 2:171415317-171415339 TATATTAAGAAGAAAATGCAAGG - Intronic
941994779 2:171592051-171592073 TATTTTTAGGAGAAAATGGATGG + Intergenic
942055367 2:172177351-172177373 TATTTTATACTGTAAGTGAAAGG - Intergenic
942635518 2:178000028-178000050 TAGAGTATGCAGAATATGAAAGG + Intronic
942965392 2:181886691-181886713 TATTTTATGAAGACCAGGAAAGG - Intergenic
943220805 2:185102994-185103016 TATTTTATGGTAAAAATAAAAGG + Intergenic
943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG + Intergenic
943887773 2:193244853-193244875 AATATTATGTAGATAATGAATGG + Intergenic
943908570 2:193532866-193532888 TATTTTGTGCTAAAAAGGAAGGG - Intergenic
943966943 2:194348151-194348173 TACTTTTTGCAGAAATTGGAGGG - Intergenic
944065831 2:195618046-195618068 TATTTTAAAAAGAAAAAGAAGGG + Intronic
944116968 2:196198034-196198056 TTTCTTGTGCACAAAATGAATGG - Exonic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
945012909 2:205483805-205483827 TATTTTATGTAGAATTGGAAGGG + Intronic
945450649 2:209991428-209991450 TTTTGTATGCAAAAAATGACTGG - Intronic
946060827 2:216940074-216940096 TTTTTAAGGCAGAAATTGAAAGG + Intergenic
946350730 2:219150118-219150140 AATTTTACCTAGAAAATGAATGG - Intronic
946647420 2:221852601-221852623 TATTTGATGTAGAAAAGTAAGGG + Intergenic
946684036 2:222249216-222249238 TATTTTTTGTAGAAACTGAAAGG - Intronic
948014298 2:234675347-234675369 TATTTGATGTAAAAAATGGATGG - Intergenic
948230469 2:236345431-236345453 AGTTTTCTGCTGAAAATGAATGG + Intronic
1169529527 20:6469542-6469564 TATTACATTCTGAAAATGAATGG + Intergenic
1169546693 20:6657667-6657689 TATTCTGAGCAGGAAATGAATGG + Intergenic
1169598983 20:7235417-7235439 TCTTTTATGCAGAGGATGAGTGG - Intergenic
1169680355 20:8204858-8204880 TATTTAAGGCAGAAAATCATAGG - Intronic
1170005083 20:11659091-11659113 AATTTTATGGAAATAATGAAAGG + Intergenic
1170473757 20:16693983-16694005 AATTTTATGACAAAAATGAAGGG + Intergenic
1170720056 20:18868950-18868972 TATTCTGTGAAGAAAATTAATGG + Intergenic
1171501540 20:25597393-25597415 TATTTTAACCAGAAACTGTAAGG - Intergenic
1171912050 20:30971977-30971999 TATTCTATGAAGAAAGTGATTGG + Intergenic
1172561684 20:35894435-35894457 TAATTTATGCTGCTAATGAAAGG + Intronic
1172710521 20:36919213-36919235 TGTTTAATGCAAAAAATAAAAGG - Intronic
1174057942 20:47811454-47811476 ACATTTAGGCAGAAAATGAAGGG - Intergenic
1174263705 20:49316344-49316366 TATTTTAATAAGAAAAGGAAAGG - Intergenic
1176586381 21:8591670-8591692 AATATTAGGTAGAAAATGAAGGG + Intergenic
1176743085 21:10624388-10624410 AATATTAGGTAGAAAATGAAGGG + Intergenic
1176841443 21:13846353-13846375 AAATTTAGGCAGAAAATCAAGGG + Intergenic
1177351815 21:19952743-19952765 AATTCTATGAAGAAAATCAATGG + Intergenic
1177413558 21:20764435-20764457 AATTTTATCCAGAAAAAGAAAGG + Intergenic
1178068457 21:28934001-28934023 TTTGTTATGGGGAAAATGAAGGG - Intronic
1178173254 21:30066592-30066614 TAACTCATTCAGAAAATGAAAGG - Intergenic
1179723290 21:43327851-43327873 TATTTTAAGGATAAAAAGAATGG - Intergenic
1180269189 22:10568573-10568595 AATATTAGGTAGAAAATGAAGGG + Intergenic
1180534315 22:16383733-16383755 AATATTAGGTAGAAAATGAAGGG + Intergenic
1181413555 22:22743633-22743655 TAATTTATAGAGAAAATAAAAGG + Intronic
1182410393 22:30180538-30180560 TATCTTATCTAGAAAATGAGAGG - Intergenic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1183130893 22:35834825-35834847 GATTTTATTCAGAGACTGAAGGG + Intronic
1183769095 22:39908130-39908152 GGTTTTCTGCAGAAAATCAAAGG - Intronic
1184122200 22:42459275-42459297 TATTTCAAGCAGAAGATCAATGG + Intergenic
1203238112 22_KI270732v1_random:27319-27341 AATATTAGGTAGAAAATGAAGGG + Intergenic
1203289546 22_KI270735v1_random:21065-21087 AATATTAGGTAGAAAATGAAGGG - Intergenic
1203315328 22_KI270737v1_random:2063-2085 AATATTAGGTAGAAAATGAAGGG - Intergenic
949665704 3:6337098-6337120 TATTATAAGCAGAAAATAACAGG - Intergenic
949795913 3:7850891-7850913 TATCTTAGGAAGAGAATGAATGG + Intergenic
949937611 3:9128441-9128463 AATTTTATGAAGCAAGTGAAAGG + Intronic
949991531 3:9583273-9583295 AATTTCTTGCAGCAAATGAACGG - Intergenic
950137674 3:10593167-10593189 TATTTTTAAAAGAAAATGAAAGG + Intronic
950182888 3:10927469-10927491 TATAAAATGCAGACAATGAAAGG - Intronic
950373035 3:12547210-12547232 TACTTTCTGGAGAAAATTAATGG + Intronic
950610052 3:14120739-14120761 TATTTGTTGAAAAAAATGAATGG + Intronic
951119185 3:18904297-18904319 TAATTTATAAAGAAAATTAAAGG - Intergenic
951285782 3:20811589-20811611 TTTTTTTTGTAGAAGATGAATGG - Intergenic
951361227 3:21726787-21726809 TATTCTATGAAGAAAGTCAATGG - Intronic
951676031 3:25242833-25242855 AATTTTATGAAGAAAGTCAATGG + Intronic
951730052 3:25800234-25800256 TAGTTCAAGTAGAAAATGAATGG - Intergenic
952347934 3:32505641-32505663 CAATTTATGAAGAAAATGTAAGG - Intergenic
952606833 3:35157889-35157911 TATTTTATGCACATAATTTACGG + Intergenic
952802154 3:37304344-37304366 TATTTTATGGATAAAGTGACTGG + Intronic
954558550 3:51537343-51537365 TATTTTCTGGAGGTAATGAAAGG - Intergenic
955229976 3:57089998-57090020 TATTTAATGCAGAAATTCTAAGG + Exonic
955270629 3:57494706-57494728 TATTGTATACAGAAAATTCAGGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956752977 3:72359611-72359633 TATTTTAAGCTGAAAATAGATGG + Intergenic
957358380 3:79120760-79120782 AATTGTATACAGAAAAGGAAAGG + Intronic
957460858 3:80518017-80518039 TAGTTTATATAGAAAATGCAGGG - Intergenic
957844871 3:85718856-85718878 TATTTTATAGAGGAAATTAATGG + Intronic
958425937 3:93978836-93978858 TTATTTAAGTAGAAAATGAATGG + Intergenic
958727075 3:97919076-97919098 TAGATTTTGGAGAAAATGAAAGG + Intronic
958843251 3:99234235-99234257 CATTTCATGCTGAAAATGGATGG + Intergenic
959017139 3:101147607-101147629 TATTCTATGTAGAGAATTAAAGG - Intergenic
960059460 3:113305423-113305445 CTTTTCATGCAGAAAATAAAAGG - Intronic
960170841 3:114459121-114459143 TATTATGTGCAGAATATGCATGG - Intronic
960175350 3:114511184-114511206 TATCTTATGCAGTAAATGTAAGG + Intronic
960372562 3:116859241-116859263 GCTTTTGTGCAGAGAATGAAAGG - Intronic
961839121 3:129693694-129693716 TAGTTTAAGGAGAAAGTGAAAGG - Intronic
962426247 3:135271526-135271548 TATTTTATGAAGAAAATTACTGG - Intergenic
962630394 3:137269820-137269842 TTTTTTATGCAGGAAATAATGGG - Intergenic
963022029 3:140881424-140881446 TATTCTGTGAAGAAAATCAATGG - Intergenic
964050892 3:152392065-152392087 TTTTTTTTGCACAAAATGACAGG - Intronic
965129333 3:164674979-164675001 TATTTTATGTACAAAATAATAGG + Intergenic
965162201 3:165148682-165148704 AATTTCATGCAGAAAAAGAGAGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965212623 3:165813675-165813697 TATTTTCTGCAGAAATTTCAAGG + Intronic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
965411355 3:168335653-168335675 TATTTTATTCATCAAAAGAAAGG + Intergenic
965630774 3:170730470-170730492 TCTGTTTGGCAGAAAATGAAGGG - Intronic
965873061 3:173283711-173283733 TCTTTAATGATGAAAATGAAAGG - Intergenic
965882447 3:173401908-173401930 TATTTTACTTAGAAAATAAATGG + Intronic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
965983013 3:174715916-174715938 TATTTTTTGTAGAATATGAATGG + Intronic
966031931 3:175360205-175360227 AATTTCATGCAGGAAATTAATGG - Intronic
966262609 3:177997635-177997657 TATATTCTACAGAAACTGAAAGG - Intergenic
966435876 3:179883442-179883464 TATTTTATGCACAATATTCACGG - Intronic
966634864 3:182121346-182121368 TATTTTATGCAGAGAAGAAATGG + Intergenic
966692971 3:182760481-182760503 TATTTTAAGGATAAAATGAGGGG - Intergenic
967343754 3:188429812-188429834 TATTGAATGCAGAAAGGGAATGG + Intronic
969921014 4:10539847-10539869 TATTTTATGTAAGAACTGAAAGG - Intronic
970125486 4:12805190-12805212 TATCTTATGGAGAAATTGAAAGG - Intergenic
970845318 4:20530797-20530819 TATTTTACTCAGCTAATGAATGG + Intronic
970870369 4:20810223-20810245 CATTTTGTGGAGAAAATGAGAGG + Intronic
971271584 4:25153251-25153273 TATTTTCTTCATAAAATAAAAGG + Intronic
971413697 4:26402485-26402507 TATTTTATTCGTAAAATGAGAGG - Intronic
971661257 4:29419225-29419247 TATTATTTGGAGCAAATGAAAGG - Intergenic
971997426 4:33983211-33983233 TATTCTAGGAAGAAAAGGAATGG - Intergenic
972090882 4:35281925-35281947 TCTTTTTGGCAGAAACTGAAAGG + Intergenic
972153920 4:36132997-36133019 TATTTTATGCATATAAAGGAAGG + Intronic
972182522 4:36486525-36486547 TATTTTATACATAAAACAAAAGG - Intergenic
972669511 4:41201298-41201320 TATTTTCTGAAGATAATAAAAGG + Intronic
973113419 4:46424162-46424184 TATTTTATGCAGTAGCAGAAGGG + Intronic
973205954 4:47560365-47560387 TATTTTATGTGGTTAATGAATGG - Intronic
973757291 4:54087923-54087945 TGTTTTAAACAGAAAATAAAAGG + Intronic
974137752 4:57840086-57840108 TATTTTGGGTAGAAAAAGAATGG - Intergenic
974200525 4:58633297-58633319 CTCTTTCTGCAGAAAATGAATGG - Intergenic
974920788 4:68236807-68236829 TATATCATCCAGAAAGTGAAGGG - Intronic
975070456 4:70131139-70131161 TATTTTATCCAGAACATAAAGGG - Intergenic
975078074 4:70238189-70238211 TATGTTATGAGGAAAATAAAAGG + Intergenic
975902492 4:79169221-79169243 AATTCTATGAAGAAAATCAATGG - Intergenic
975909949 4:79255882-79255904 TATTTTATGCAGAAATTTCCAGG + Intronic
975912491 4:79283544-79283566 TATTTTAATCAGAAAAGCAAAGG + Intronic
976157004 4:82156931-82156953 TAATTTTTGTATAAAATGAAAGG - Intergenic
976248916 4:83031176-83031198 TAGCTGATGTAGAAAATGAATGG + Intergenic
976430577 4:84959288-84959310 AATTTTAAGCAGAAAAAAAAAGG + Intronic
976627859 4:87206423-87206445 TACTTTATGTAAAAAATGAATGG - Intronic
977747334 4:100565141-100565163 TATTTTATCCTGAAAATTAGTGG - Intronic
978013458 4:103715786-103715808 TACTATATGCCGTAAATGAATGG + Intronic
978262634 4:106779435-106779457 TATTTAGAGTAGAAAATGAATGG + Intergenic
978486173 4:109256249-109256271 TTTTTCATTCAGAAAATGTATGG + Intronic
978614355 4:110579211-110579233 TATATTATACCGAAAATAAAAGG + Intergenic
978684120 4:111418037-111418059 TATTTTAATAAGAAAATGAAAGG - Intergenic
978749091 4:112227333-112227355 TATTTTATTCTGAAGTTGAAGGG - Intergenic
979040600 4:115787929-115787951 TTTTTTCTGCAGAAAATTATTGG + Intergenic
979536470 4:121826551-121826573 TATTTTAGGAAGATAATGAAAGG + Intronic
979587011 4:122432387-122432409 AATATTATGCAGATAATTAACGG + Intergenic
979959204 4:126995991-126996013 TATTTTACCCTGAAAATGCAAGG + Intergenic
980029779 4:127813976-127813998 TATTATATAAAGAAAATTAAAGG - Intronic
980159499 4:129142695-129142717 TATTTTATAAAGGATATGAAGGG - Intergenic
980608073 4:135119828-135119850 TATTTTATGGGAAAACTGAAGGG - Intergenic
980707724 4:136521050-136521072 TAATTTATGAAGAAAAAAAAAGG + Intergenic
980773351 4:137407655-137407677 TATTTTCTTCTGAAAATGGAGGG - Intergenic
980789667 4:137603706-137603728 TAATTTATAAAGAAAATGAATGG - Intergenic
981104094 4:140860948-140860970 TTTTTTTTCCAGAAAATGGATGG + Exonic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981930045 4:150179987-150180009 ACTTTTATGGAGTAAATGAATGG - Intronic
982194493 4:152896983-152897005 TATTTTCTTCTGTAAATGAAAGG - Intronic
983490054 4:168378521-168378543 AAATTTAGGCAGAAAATAAATGG - Intronic
984007729 4:174333655-174333677 AAAATTATGCAAAAAATGAAGGG + Intergenic
984894985 4:184530399-184530421 TAATTTATAAAGAAAAAGAACGG - Intergenic
985319798 4:188697934-188697956 TATTTTATTTAGAGAACGAAAGG - Intergenic
986780430 5:11060234-11060256 TATATTATAATGAAAATGAATGG - Intronic
986832923 5:11601387-11601409 TTTTTTGTGAAAAAAATGAAAGG + Intronic
987625759 5:20398282-20398304 CATTTTAAGAAAAAAATGAAAGG - Intronic
987794732 5:22612222-22612244 TATTTTTTGAAGAAAACTAATGG - Intronic
988730310 5:33966153-33966175 TATTTTATGGAAAAAATATAAGG + Intronic
988789418 5:34593591-34593613 TATTTTATCCAGTTAATGGATGG - Intergenic
989326575 5:40203420-40203442 TAATTTATTAAGAAAATTAATGG + Intergenic
990129286 5:52559832-52559854 TATTTTATTAAAAAAATGAAAGG + Intergenic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990647510 5:57860986-57861008 TATTTAATTCTGAAAATGCAAGG + Intergenic
990806524 5:59669040-59669062 TAGGTTATGAAGAAAATAAAAGG + Intronic
990863343 5:60352732-60352754 TATTTTATAAGGAAAATTAATGG + Intronic
991071765 5:62490976-62490998 TATTGAATGCATAAAATGAAAGG + Intronic
991088162 5:62667429-62667451 TCTTGTAATCAGAAAATGAAAGG + Intergenic
992152710 5:73921457-73921479 TATCTTATCCAGAAAGAGAATGG - Intronic
992285268 5:75228684-75228706 TATATCATGTAGAAAATGAAAGG - Intronic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992712591 5:79474760-79474782 AATTCTCTGCAGAAACTGAAAGG + Intronic
992849995 5:80797441-80797463 CATTTTGTGTAGAAAATAAAAGG - Intronic
993309895 5:86315705-86315727 TATTTTATGTACAATATCAATGG + Intergenic
993667229 5:90714716-90714738 TATTTCATGTTGAAAATTAATGG - Intronic
993739244 5:91517459-91517481 TAATTTATGCAGACAAGAAAGGG + Intergenic
993756472 5:91736326-91736348 TATTTTTTTTAAAAAATGAAAGG - Intergenic
993862380 5:93151779-93151801 CATTTAGTTCAGAAAATGAAGGG - Intergenic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
995034512 5:107518159-107518181 TATTCTATTTAGAAAATAAAAGG + Intronic
995112917 5:108447129-108447151 TATTTTGTGAAGAAATTGACTGG + Intergenic
995126227 5:108579299-108579321 TACGTTGTGCTGAAAATGAAAGG - Intergenic
995980321 5:118094595-118094617 TATATTATGAAGAAAACAAAAGG + Intergenic
996233834 5:121102364-121102386 TATCTTATACACAAAATGCAGGG - Intergenic
996646135 5:125819475-125819497 AATTTTATGCAGAAAAAGATAGG - Intergenic
996648407 5:125844035-125844057 AATTCTATGAAGAAAATCAATGG - Intergenic
996793725 5:127321213-127321235 TATTTTATCCATAAAATGAAAGG + Intronic
997033547 5:130159941-130159963 TTTTTTTTGAAGAAAATCAAAGG + Intronic
997103028 5:130989443-130989465 TATTTTATGGAGATATTAAAAGG + Intergenic
998305825 5:141076264-141076286 TACTCTATGCTGAAAATGGAGGG + Intergenic
998365555 5:141628502-141628524 TATTTCAAGGAGAAAAAGAAGGG + Intronic
999020272 5:148157930-148157952 AATACTATGCAGCAAATGAAGGG - Intergenic
1000076545 5:157793334-157793356 TCTATAATGCAGAATATGAATGG + Intronic
1000137741 5:158369078-158369100 AATTTTCTGCAAAAAATGATTGG - Intergenic
1000302011 5:159965120-159965142 TATTTGCTGAAGCAAATGAATGG + Intronic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1000926556 5:167201384-167201406 TTTTACATGCTGAAAATGAATGG + Intergenic
1001807856 5:174603875-174603897 TAATTTATGCAGAAAATTCAAGG - Intergenic
1002353349 5:178601772-178601794 TATTTTAAACATAAAATGCATGG - Intergenic
1003671144 6:8161559-8161581 TGCTTTTTACAGAAAATGAAGGG + Intergenic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004539566 6:16537267-16537289 TATTCTACGCAGCAAATCAATGG + Intronic
1004759203 6:18647604-18647626 AATTTTTTGCATAAAATAAAGGG + Intergenic
1005573602 6:27171331-27171353 TTTTTTTTGCAGAAATGGAAAGG - Intergenic
1005599695 6:27413732-27413754 TGTTTTATTTACAAAATGAAGGG - Intergenic
1005912671 6:30325166-30325188 GATTTTATGCTGAATATGGAAGG - Intergenic
1008114756 6:47535502-47535524 TATTTTATGAAAATAATCAAAGG - Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1008457734 6:51730866-51730888 TATTTTATGCCTAAGATGAATGG - Intronic
1008504298 6:52214388-52214410 TATTTTCTGCATAAAATAAGAGG + Intergenic
1009858788 6:69297859-69297881 TATGTAAGGGAGAAAATGAATGG - Intronic
1009981300 6:70729069-70729091 AATCTTAGGGAGAAAATGAAAGG - Intronic
1010440083 6:75883996-75884018 TATTTTATTTGGAAAATGATGGG - Intronic
1010973224 6:82284696-82284718 TCTGTTTTTCAGAAAATGAACGG + Intergenic
1011486094 6:87843399-87843421 TAATTTATACAGAAAATTAGAGG - Intergenic
1012081596 6:94764885-94764907 AATTTTATTCAGAAACTTAAAGG + Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012330829 6:97984288-97984310 TATTTTTTGCATAAATTGAGAGG - Intergenic
1012641585 6:101624537-101624559 TATTTTATGGAGAAAACTGAGGG + Intronic
1012694441 6:102360120-102360142 AATTTTATATAGAAAATAAAAGG + Intergenic
1012759968 6:103287755-103287777 TAATTAATGCTGAGAATGAACGG + Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1012959484 6:105607676-105607698 TATTTTCTTGAGAAAATGAATGG + Intergenic
1012984611 6:105861929-105861951 TAATTTATTAAGAAAATCAATGG + Intergenic
1013721339 6:113032312-113032334 TATTAGATGCAAAAAATGAGAGG + Intergenic
1013797000 6:113899361-113899383 TTTTTAATCCAGAGAATGAATGG - Intergenic
1013916997 6:115352926-115352948 ATTTTTATTCAGAAAATGATGGG + Intergenic
1014535761 6:122611036-122611058 TATTTTATCCAAAGAATGGACGG - Intronic
1014560224 6:122880828-122880850 AATTCTATGCAGAAAGTCAATGG + Intergenic
1014670308 6:124295855-124295877 TATTTTATGGAGAAGAGTAAAGG - Intronic
1015236730 6:130979600-130979622 TATTTAATGGATAAAATGAATGG + Intronic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1016449069 6:144162491-144162513 TATTTTATCCAGAATGTGGAAGG + Intronic
1018232000 6:161683953-161683975 TGTTTTATGCAGATAATTCAGGG - Intronic
1018709534 6:166488115-166488137 TATTTTAACAAGAAAACGAAAGG - Intronic
1019201639 6:170321181-170321203 AATTTTATAGAGAAAATGTAAGG - Intronic
1020740350 7:12008571-12008593 TATATTAAGCACAAAATGAATGG + Intergenic
1020760654 7:12264733-12264755 TAAATTATTCAGACAATGAAAGG - Intergenic
1021029883 7:15718814-15718836 TATTTTAAGAAAAAAAGGAATGG + Intergenic
1021091983 7:16494820-16494842 TATTTTATGCAGAACCTCACAGG + Intronic
1021215402 7:17910161-17910183 TATTTATTGCACAAAATAAAAGG - Intronic
1022839923 7:34154183-34154205 TATTTCATGTATAAAATGAAAGG + Exonic
1022893190 7:34722021-34722043 TATTTTATAGAGAAAAGGAGGGG + Intronic
1024108795 7:46123191-46123213 AATTTTATCAAGAATATGAAAGG - Intergenic
1024758179 7:52561768-52561790 TATTTTATGGCCACAATGAATGG - Intergenic
1024772599 7:52742338-52742360 TATTTCATGAAGGAAATAAATGG + Intergenic
1024804711 7:53124597-53124619 AATATTAGGTAGAAAATGAAGGG - Intergenic
1024829776 7:53437132-53437154 CATCTTAGGTAGAAAATGAAGGG - Intergenic
1024872336 7:53979977-53979999 TATTTAATGCAGAGAATTAGAGG + Intergenic
1025481436 7:60988786-60988808 AATATTAGGTAGAAAATGAAGGG + Intergenic
1025838465 7:65120063-65120085 AATATTAGGTAGAAAATGAAGGG + Intergenic
1025878812 7:65513030-65513052 AATATTAGGTAGAAAATGAAGGG - Intergenic
1025884607 7:65575918-65575940 AATATTAGGTAGAAAATGAAGGG - Intergenic
1027277733 7:76577824-76577846 TATTCTGTCCAGAAAATAAATGG + Intergenic
1027887990 7:83934103-83934125 TATTTAGTGTATAAAATGAAGGG - Intergenic
1027930702 7:84530792-84530814 TATTTTATTCAAAATAGGAATGG - Intergenic
1028435895 7:90803358-90803380 TATTTAAGGCAAAAAATTAATGG + Intronic
1028476034 7:91254253-91254275 AATTTTATGAAGAAAGTCAATGG + Intergenic
1028505267 7:91563466-91563488 TATTTTCTGCAGACTAGGAATGG + Intergenic
1028735897 7:94211647-94211669 TTTTTTATGAGGAAAAGGAAAGG + Intergenic
1028802891 7:94987622-94987644 TATTTTATGCAACCATTGAAAGG + Intronic
1029678037 7:102085219-102085241 CATATTATGCATAAAATGCATGG - Intronic
1030110061 7:106019396-106019418 TTTTTTTTAAAGAAAATGAATGG + Intronic
1030329916 7:108260356-108260378 TATTTATTGAAAAAAATGAATGG + Intronic
1030962461 7:115943766-115943788 ATTGTTGTGCAGAAAATGAAGGG - Intronic
1031111734 7:117618675-117618697 TATTTTAAGGAGATACTGAACGG - Intronic
1031329102 7:120441474-120441496 TTTTTAATGCTGAGAATGAATGG + Intronic
1031485911 7:122324046-122324068 TATTTTACAAAGAAACTGAAAGG - Intronic
1031608667 7:123799263-123799285 TATTTTAACCAGAAAATTAAAGG - Intergenic
1031860410 7:126973285-126973307 TATTTTATACAGCAAAGCAATGG - Intronic
1032427890 7:131836235-131836257 TATTTTATGCCGATAATAAGCGG - Intergenic
1032708896 7:134445645-134445667 TATTTTATGAAGCAAACAAAGGG + Intronic
1032806407 7:135359247-135359269 TTTTTTCTGCAGAAATTTAAAGG - Intergenic
1032940913 7:136790216-136790238 GATTTTATTTACAAAATGAAGGG - Intergenic
1032944133 7:136830503-136830525 TATTTTATGAAAATAATGAGCGG - Intergenic
1033083855 7:138324006-138324028 AATTTTATGAAGAGAAAGAAAGG - Intergenic
1033239070 7:139662367-139662389 AATGTTATGAAGAAAATAAATGG + Intronic
1033301260 7:140188281-140188303 GATGTCATGGAGAAAATGAAAGG + Intergenic
1033912003 7:146275155-146275177 TATTTGATACAGAAAATGAGAGG - Intronic
1034060581 7:148083610-148083632 TATTTCATGCATAAAAGGAAAGG - Intronic
1034082275 7:148290039-148290061 TGTTATATGCAGAATATAAAGGG + Intronic
1035441204 7:158902503-158902525 CTATTAATGCAGAAAATGAAAGG + Exonic
1036027103 8:4921608-4921630 TATTTTACTCAGATAATGGAAGG + Intronic
1036982852 8:13490127-13490149 TATTTGGTCTAGAAAATGAATGG - Intronic
1037110023 8:15154638-15154660 TATTTTGTAAAGAAAATTAAAGG + Intronic
1037428774 8:18787166-18787188 TAATTTGGGAAGAAAATGAATGG - Intronic
1037629259 8:20638097-20638119 TGGTTTGAGCAGAAAATGAAAGG + Intergenic
1037631188 8:20657857-20657879 TATTTTAAGCTGAATATCAAGGG - Intergenic
1037713962 8:21380970-21380992 TATATTTTGTAGAAAATGTAAGG - Intergenic
1039214375 8:35252903-35252925 TATTATATCCAGTAAATGACTGG - Intronic
1039228468 8:35416897-35416919 TATTTATTGCAGAGAAAGAAGGG + Intronic
1039331363 8:36540981-36541003 AAATTTATGAAGAAAATCAAAGG + Intergenic
1039359955 8:36865456-36865478 AGTGTTATTCAGAAAATGAATGG + Intronic
1040440202 8:47433488-47433510 TAGTCTAGGCAGAACATGAATGG + Intronic
1040606538 8:48938498-48938520 TATTTTCTGAACAAAAGGAAAGG - Intergenic
1040939200 8:52815478-52815500 TATTCTCTGGAGAAAATGATTGG + Intergenic
1041605470 8:59778116-59778138 AATTTCATGGAGGAAATGAAAGG - Intergenic
1042060712 8:64814131-64814153 TATTTTCTGCAGATCATGACTGG - Intergenic
1042189821 8:66174668-66174690 AATATTATGCAGATGATGAAAGG + Exonic
1042709729 8:71703645-71703667 CAGTTTATCCAGAAAATGCATGG - Intergenic
1042896028 8:73668929-73668951 TACTTTAAGTAGAAAATAAAAGG + Intronic
1043414765 8:80035417-80035439 TATCATATCCAGAATATGAAGGG + Intronic
1043552487 8:81390432-81390454 TATTTTCAGCATCAAATGAAGGG - Intergenic
1043742787 8:83835064-83835086 TATTTTTTGAACAAAATGGATGG + Intergenic
1043811463 8:84746855-84746877 TTTTTTATGTAGATAATGTAAGG + Intronic
1043835498 8:85040698-85040720 TAGTGTTTGCAGGAAATGAAGGG + Intergenic
1044445773 8:92273617-92273639 TATTTTTTTAAGAAAATCAAAGG + Intergenic
1044506137 8:93022189-93022211 TATTAAATGCACAAAAAGAAAGG - Intergenic
1045789368 8:105964085-105964107 TACTTTATCAAGAAAAGGAAGGG + Intergenic
1046637789 8:116691468-116691490 TATGTCAGGCAGAAAATGCATGG - Intronic
1046940522 8:119926374-119926396 TGTTTTATGCTAAAAAAGAAAGG - Intronic
1047176588 8:122546960-122546982 AATTTTATTCAAAAAATAAAAGG + Intergenic
1047662349 8:127051274-127051296 TTATTTATGCAGAATATTAACGG - Intergenic
1047800328 8:128302575-128302597 TATACTATGCAGAAACTGTAGGG + Intergenic
1048638624 8:136327630-136327652 GATTTTAAGCAGGAATTGAATGG + Intergenic
1048876239 8:138838787-138838809 TGTTTTATGCAAAAAATAGAGGG + Intronic
1049961194 9:739922-739944 TTTTTAATGCAGAAAATAAAAGG - Intronic
1050027193 9:1348110-1348132 TATATCATGAAGAAAATGCAAGG + Intergenic
1050420711 9:5462475-5462497 TATTTTTTGTAGAAATTTAAGGG + Intronic
1050650444 9:7770218-7770240 TATTCTCTCCAGAAAATGATTGG + Intergenic
1050752990 9:8963158-8963180 TTTTTTATACTGTAAATGAATGG - Intronic
1050921474 9:11206788-11206810 TATTTTATCTAGAAAAATAAAGG + Intergenic
1050973502 9:11907924-11907946 AATTCTATGAAGAAAATCAATGG + Intergenic
1051227292 9:14913535-14913557 TATCTTTTGCAAATAATGAAAGG - Intergenic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1051591401 9:18779664-18779686 GATTTTTTGGAGAAAATGACAGG - Intronic
1051752240 9:20354697-20354719 ACTTTGATGAAGAAAATGAAAGG + Intronic
1051865927 9:21682634-21682656 TATTTAATACAGAAAATGGGTGG - Intergenic
1052196486 9:25722147-25722169 TATTTTAAATAGAAACTGAATGG - Intergenic
1052324409 9:27202009-27202031 TATTTGATCCAGGAAAAGAATGG - Intronic
1052443728 9:28532443-28532465 TTTTTTTTCCAGAAAAAGAAGGG + Intronic
1053034837 9:34815991-34816013 TATGTCATGCAGACTATGAAAGG - Intergenic
1053667567 9:40326829-40326851 AAATTTAGGCTGAAAATGAAGGG - Intronic
1053697904 9:40654736-40654758 AATATTAGGTAGAAAATGAAGGG - Intergenic
1053917150 9:42951932-42951954 AAATTTAGGCTGAAAATGAAGGG - Intergenic
1054162681 9:61686521-61686543 TATTTTATAGAAAACATGAAGGG + Intergenic
1054309195 9:63454144-63454166 AATATTAGGTAGAAAATGAAGGG - Intergenic
1054378710 9:64466856-64466878 AAATTTAGGCTGAAAATGAAGGG - Intergenic
1054407990 9:64778262-64778284 AATATTAGGTAGAAAATGAAGGG - Intergenic
1054441136 9:65262092-65262114 AATATTAGGTAGAAAATGAAGGG - Intergenic
1054489140 9:65759397-65759419 AATATTAGGTAGAAAATGAAGGG + Intergenic
1054517044 9:66049456-66049478 AAATTTAGGCTGAAAATGAAGGG + Intergenic
1055075390 9:72209809-72209831 TATTTTCTAGAGAAAATGAATGG - Intronic
1055201634 9:73670080-73670102 TATTTTATTCAGAAAATGTTTGG + Intergenic
1055619001 9:78103990-78104012 TACATTAAGCAAAAAATGAAAGG - Intergenic
1055794563 9:79961035-79961057 AATTTTATGTATTAAATGAAAGG + Intergenic
1056316641 9:85396729-85396751 TATGTTATGCAGATAATGATAGG - Intergenic
1056483081 9:87025664-87025686 TTTATTATACAGAAAAGGAAAGG + Intergenic
1056562448 9:87743453-87743475 TATTTTATAAAGGAAAAGAAAGG - Intergenic
1057448386 9:95135266-95135288 TCTTTTAGTCAGAGAATGAAAGG - Intronic
1058037800 9:100272390-100272412 TCTTTTCTGCAGAAATTTAAAGG + Intronic
1058348130 9:103989203-103989225 TATTTTATCTATAAAATGAGAGG - Intergenic
1058398941 9:104590967-104590989 TATTTTGTGCATAAACTCAAAGG - Intergenic
1058846622 9:108966804-108966826 TAATATAGGCAGAAAATGGATGG + Intronic
1059042733 9:110831279-110831301 TAATTTATTCTGAGAATGAATGG + Intergenic
1059097086 9:111429500-111429522 TTCTTCATGTAGAAAATGAAGGG - Intronic
1059140649 9:111849780-111849802 TATTAAATGCAAATAATGAAAGG - Intergenic
1059375518 9:113877744-113877766 TGTTTTATCCAGAAAATGTCAGG + Intronic
1059814285 9:117894127-117894149 TATAATATGTAGAATATGAATGG - Intergenic
1060429060 9:123533022-123533044 CATTTTATGTAGGAAATGCAGGG + Intronic
1061839531 9:133349747-133349769 TATTTCATCCAGAACATGAGGGG + Intronic
1202780267 9_KI270717v1_random:27930-27952 AATATTAGGTAGAAAATGAAGGG - Intergenic
1203441171 Un_GL000219v1:9927-9949 TGTTTTATGTAGAAGAAGAAGGG - Intergenic
1203382500 Un_KI270435v1:70021-70043 TATTTTTTGCAGAATCTGCAAGG + Intergenic
1203511980 Un_KI270741v1:128835-128857 TGTTTTATGTAGAAGAAGAAGGG - Intergenic
1203616281 Un_KI270749v1:69180-69202 AATATTAGGTAGAAAATGAAGGG + Intergenic
1187303632 X:18075277-18075299 TCTTTTATGGGGAAAATGAAAGG + Intergenic
1187347821 X:18482715-18482737 TATTTCATACAGTTAATGAAAGG + Intronic
1187551322 X:20308733-20308755 TATTTTAATCATAAAAAGAAAGG + Intergenic
1187993182 X:24897587-24897609 TTGTTTCTGAAGAAAATGAAGGG + Intronic
1188359004 X:29229321-29229343 AATTTTCTGCAGAAAATTTAAGG - Intronic
1188461994 X:30438584-30438606 GTTTTGATGCAGAAAATGGAAGG - Intergenic
1188882710 X:35509807-35509829 GATTTTATGAAGTGAATGAAAGG + Intergenic
1188909492 X:35828715-35828737 AATTTTATGCAGAAATTCAGGGG + Intergenic
1190539612 X:51463672-51463694 TATTTAAAGCAAAACATGAATGG - Intergenic
1191004061 X:55691497-55691519 AATTCTGTGCAGAAAATCAATGG - Intergenic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1192765128 X:74132272-74132294 TATTTTAAGCAGATAAGAAAAGG + Intergenic
1192796939 X:74431728-74431750 TACTTTAATAAGAAAATGAAGGG + Intronic
1193257265 X:79364753-79364775 AAGTTAATGCAGAAGATGAAAGG + Intronic
1193688367 X:84607317-84607339 TATTTTTTGCATATGATGAAAGG + Intergenic
1193690685 X:84637876-84637898 TTTTTGATGTAGAAAATTAATGG - Intergenic
1193729475 X:85085614-85085636 TCTTTTATGCAGAAAAGGTATGG + Intronic
1193871228 X:86801170-86801192 TGTTTTATACAAAAAATTAAGGG - Intronic
1194886596 X:99323018-99323040 AATTTTATGAAGAAAGTCAATGG - Intergenic
1195315733 X:103676003-103676025 TGTTTTAAACAGAAAATAAAAGG - Exonic
1195403025 X:104482059-104482081 TATTATAGCCATAAAATGAATGG - Intergenic
1196108715 X:111923515-111923537 TATTTTATGAAGAAAATATATGG - Intronic
1196119283 X:112031225-112031247 TATCTTCTGCAGAAAAGAAAAGG + Intronic
1196562878 X:117172335-117172357 TATTATAAGCAGCAAATGAAAGG + Intergenic
1196692076 X:118570733-118570755 CATTGTAGGCAGAAAATGATTGG - Intronic
1197248625 X:124191778-124191800 TATATGATGCAAAAAAGGAATGG - Intronic
1197320724 X:125026691-125026713 GAGTTTATCCAAAAAATGAAAGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197536932 X:127701728-127701750 TTTTTAATCCATAAAATGAAGGG - Intergenic
1197538689 X:127726256-127726278 CATTTTACTCAGGAAATGAATGG + Intergenic
1197656184 X:129118424-129118446 TTTTATATTCAGAAAATTAATGG - Intergenic
1197813874 X:130476774-130476796 TAATTTAGGTAGAAAAAGAAGGG + Intergenic
1197881116 X:131167668-131167690 TATTTTCTGCAGCAAAGAAAGGG + Intergenic
1198981781 X:142405975-142405997 AATTTTGTGAAGAAAATCAATGG - Intergenic
1199029480 X:142979989-142980011 TATTTTATTGAGAAAATAGAAGG + Intergenic
1199180010 X:144842927-144842949 AGTTTTATTCAGAAAATTAAAGG + Intergenic
1199621833 X:149708468-149708490 AATTCTATGAAGAAAAAGAAAGG + Intronic
1199808073 X:151321263-151321285 AAATTTATACAGAAAATCAAAGG - Intergenic
1200278224 X:154753907-154753929 TATTTTAAACAAAAAATAAATGG - Intergenic
1200386624 X:155898131-155898153 TATCTCATTCAGAAAATTAAAGG - Exonic
1200394970 X:155980059-155980081 TTTTTTTTTCAGAAAATCAAAGG - Intergenic
1200977745 Y:9230282-9230304 TTCTTTATTCAGAAAATCAAGGG + Intergenic
1201195034 Y:11484654-11484676 AATATTAGGTAGAAAATGAAGGG - Intergenic
1201231088 Y:11865229-11865251 AATTTTGTGTAGAAAGTGAATGG - Intergenic
1201336343 Y:12884497-12884519 TGTTTTTTGCAGCAAATGGATGG - Intergenic
1201890786 Y:18941632-18941654 TATTTTATGAAAAAAATGTTGGG - Intergenic
1202591609 Y:26490413-26490435 TGTTTTATACAGAAAATCTAAGG + Intergenic