ID: 1012139123

View in Genome Browser
Species Human (GRCh38)
Location 6:95599530-95599552
Sequence TATTCTAATGGAGGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012139123 Original CRISPR TATTCTAATGGAGGACAATC TGG Intronic
900848975 1:5127090-5127112 TATTCTATAGGAGGACACTGAGG - Intergenic
902504754 1:16932073-16932095 TATTCTAGTGGATTAAAATCAGG - Intronic
907757937 1:57329026-57329048 TTTTCTAATGCAGGAAGATCAGG - Intronic
908112335 1:60909735-60909757 TTTTCTAATTGAGGACACTGAGG - Intronic
908656272 1:66392834-66392856 TATTCTAATTGTAGAAAATCTGG - Intergenic
908861901 1:68498691-68498713 AATTCTAATGTAGGAGAATTAGG - Intergenic
908877584 1:68695599-68695621 TATTTTAATGGAAGACACTGTGG + Intergenic
918552345 1:185757548-185757570 TAATCTGATGGAGAACAATTAGG - Intronic
918910420 1:190560903-190560925 TATTCATAAGGAGGACATTCAGG - Intergenic
922278193 1:224098821-224098843 CATTTTAATGGAGGATAATAAGG - Intergenic
922486816 1:225979786-225979808 TATTAGAAAGGAGGAAAATCAGG + Intergenic
922829201 1:228542702-228542724 AATTCTAATGGGAGAAAATCTGG - Intergenic
923289385 1:232529791-232529813 TATTCTTATGGAGGAAAAAAAGG + Intronic
923762648 1:236860927-236860949 TATTCTAATTGAGGAAACTGAGG + Intronic
1068065486 10:52125563-52125585 TGTTCCAATTGAGGGCAATCGGG - Intronic
1071123765 10:82310822-82310844 TATTCTAAGGGAGTAGAATGAGG - Intronic
1075599281 10:123755472-123755494 CATTCTAATGGAAGACTTTCTGG - Intronic
1081036613 11:38155402-38155424 TATTCAAAGAAAGGACAATCTGG - Intergenic
1084346604 11:68554804-68554826 TATTTTAATAGAGAATAATCAGG + Intronic
1088439902 11:109858591-109858613 TATTCTTATGCAAGAAAATCAGG + Intergenic
1092751358 12:11722481-11722503 TAATCTAATGGTGGACATTTTGG + Intronic
1097871828 12:64608814-64608836 TAATCTAATGTAGGAGAATAGGG - Intergenic
1098033330 12:66277247-66277269 TATTATATGGGAGGCCAATCAGG - Intergenic
1098389345 12:69952648-69952670 TATTCAAATGGAAAACAAACAGG - Intronic
1100322998 12:93514784-93514806 GTGTCTAAAGGAGGACAATCAGG - Exonic
1103381077 12:120495215-120495237 TATTCTAATGGACGAAAAAGCGG - Intronic
1103594024 12:122012316-122012338 TATCCTAGTGGAGGTCAAGCGGG - Intergenic
1104229746 12:126872997-126873019 TTTTTTAATGGAGGAAAATTTGG + Intergenic
1107496414 13:40929845-40929867 TATTCTAATGGGGGAAAAACAGG + Intergenic
1107563103 13:41575137-41575159 TATTCTAAGGGAAGAAACTCAGG + Intronic
1107585344 13:41841110-41841132 TAATATACTTGAGGACAATCTGG - Intronic
1109138663 13:58684685-58684707 TATTCAAATGGAGGGTAAGCAGG - Intergenic
1109449154 13:62485987-62486009 TTTTCTAATGGTGAAGAATCTGG - Intergenic
1109521355 13:63514787-63514809 TATTCTCATGGATGATTATCTGG + Intergenic
1111614652 13:90647140-90647162 TATTCTACTGGTAGACAAACAGG + Intergenic
1111773604 13:92629988-92630010 TATTCTAGTGGAGAACCTTCAGG + Intronic
1112777415 13:102860462-102860484 TGTTCTGATTGATGACAATCAGG + Intronic
1113435776 13:110289922-110289944 CATCCTCATGGAGGACAAGCAGG + Intronic
1115111572 14:29829399-29829421 TATCCTACTTGAGGAAAATCTGG - Intronic
1119144038 14:72294216-72294238 TATCCTAATACAGGAAAATCAGG - Intronic
1120003173 14:79326921-79326943 TATGCTGATGGAGGACATTGAGG - Intronic
1121681283 14:95794703-95794725 TATTCTAGGCGAGGACATTCTGG - Intergenic
1125169889 15:36754393-36754415 TATTAAAATGGAGAACAAACAGG + Intronic
1127952872 15:63826903-63826925 TATACTTGTGGAGGAAAATCTGG + Intronic
1128499240 15:68215759-68215781 TATTCTAAAGGAAAACAAGCAGG + Intronic
1129048054 15:72754460-72754482 AATTCTTATGGAGGGCAATCTGG + Intronic
1130778956 15:87014798-87014820 TCTTCTAATGGAGGGCAAGTAGG - Intronic
1134793423 16:17012172-17012194 TGTTCTAATGAAGGATGATCAGG + Intergenic
1138837907 16:60460390-60460412 TATTCTCATGACAGACAATCAGG - Intergenic
1140926080 16:79585242-79585264 TATTTTAATAGATGAAAATCAGG + Intergenic
1140941748 16:79727950-79727972 TTTTCTATTGGAGGACATTTAGG + Intergenic
1144543405 17:16168550-16168572 TACTCTTTTGCAGGACAATCTGG + Intronic
1145301049 17:21637758-21637780 TAGTCTTTTGCAGGACAATCTGG - Intergenic
1145349248 17:22065520-22065542 TAGTCTTTTGCAGGACAATCTGG + Intergenic
1148253210 17:46104685-46104707 TATTCTAATGGAGGAAAAAATGG + Intronic
1149078397 17:52624574-52624596 TATTGTAATGGGGGAGGATCAGG + Intergenic
1149739924 17:59035410-59035432 TATTCTATTGGAAAACAATTTGG + Intronic
1153002837 18:472142-472164 TATTCTAGAGGAGGACGCTCAGG + Intronic
1155872530 18:31045163-31045185 TATACTCATGGTGGACAAACAGG - Intergenic
1160008823 18:75088639-75088661 TGTTCTAATGGAGGCCACACAGG + Intergenic
1164375292 19:27678789-27678811 CATTCTAATGGAAGACACTGTGG - Intergenic
1164386097 19:27771578-27771600 GATTCTAATAGAAGACACTCTGG - Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
926056437 2:9776720-9776742 TATTCTAATGGGGGACACAGTGG + Intergenic
927611168 2:24542354-24542376 TTTTCAAAGGGAAGACAATCAGG + Intronic
931472860 2:62556957-62556979 TTTTCTAATGCAGAACAATTTGG - Intergenic
931806912 2:65816274-65816296 TATTCCACTGTTGGACAATCAGG + Intergenic
932227241 2:70052085-70052107 TATTCTAATGGAGGGAAGTTAGG + Intergenic
934122805 2:88856393-88856415 CATTCTATTGTTGGACAATCGGG + Intergenic
936105557 2:109621482-109621504 TATTCTAATGGAGGGCTCCCAGG - Intergenic
936415142 2:112300894-112300916 GATTTTAATGGAGGAAATTCAGG - Intronic
937409769 2:121663593-121663615 GATTCCCATGCAGGACAATCAGG - Intergenic
946526818 2:220529694-220529716 TTTTCTACTCGAGGAAAATCAGG + Intergenic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
1169088488 20:2841625-2841647 GATTCTATTGGGGGAGAATCAGG - Intronic
1172041555 20:32050173-32050195 AATTCTAATGTAGGACGATAAGG + Intergenic
1177841401 21:26237768-26237790 TAGGGTAGTGGAGGACAATCAGG + Intergenic
1178120243 21:29462219-29462241 AATGCTTATGGAGGAAAATCTGG - Intronic
1182583576 22:31329665-31329687 TATTTTGGGGGAGGACAATCCGG + Intronic
1183136041 22:35888809-35888831 TATTCTTAAGGAGGAAAACCAGG - Intronic
1183790466 22:40064251-40064273 CATTGTACTGGAGGACAATTAGG - Intronic
950357034 3:12420292-12420314 TACTCTAAGGAAGCACAATCGGG - Intronic
951352654 3:21625312-21625334 TGATCCAAAGGAGGACAATCAGG + Intronic
952187534 3:30986314-30986336 TTTTCCAATGGAGGAAACTCAGG - Intergenic
952929983 3:38352296-38352318 TTTCCTAATGGAGGACAACCCGG - Intronic
956150098 3:66232156-66232178 TAATCTACTGGAGGACAATTTGG - Intronic
957641300 3:82856809-82856831 TATCCTTCTGGAGAACAATCCGG - Intergenic
963764857 3:149324098-149324120 AATTCTAATGGAGTAAAATGAGG - Intronic
972588848 4:40465029-40465051 TATACTAATGGAAGGAAATCTGG - Intronic
973231471 4:47843954-47843976 TCTTCAAATGGAGGTCATTCAGG + Intergenic
973850098 4:54953327-54953349 TATTCTAATGAAGTACGGTCAGG + Intergenic
975328970 4:73091974-73091996 TATGCTAATGGAAGAGAAACTGG + Exonic
976274741 4:83264902-83264924 AACTCTAATGCAGGGCAATCTGG + Intronic
977233872 4:94483427-94483449 TATACTTATGAATGACAATCAGG - Intronic
981389419 4:144171202-144171224 TATCCTAATGGATAGCAATCAGG + Intergenic
981507201 4:145515392-145515414 TATTCTAAGGGAAGAAAATTAGG + Intronic
981690425 4:147501925-147501947 AATTATTATGGAGGACAATTTGG - Intronic
983636357 4:169901578-169901600 AATTCTAAGGCAGGGCAATCTGG - Intergenic
983700203 4:170582644-170582666 TGTTCTAATTGAAGGCAATCAGG + Intergenic
988326498 5:29775465-29775487 TATTCAAATGGAGGAAAACTGGG - Intergenic
989740947 5:44771223-44771245 TCTTCTAAATGAGGACAATTTGG - Intergenic
989842756 5:46100880-46100902 TATTCTAATCCAGGTCAATGTGG - Intergenic
991294741 5:65068771-65068793 GATTCAAATGGAGGACAAGAGGG - Intergenic
997047279 5:130332819-130332841 TATTCCAATTGATGGCAATCTGG - Intergenic
998715709 5:144881783-144881805 AATTCTAATGCATGCCAATCAGG + Intergenic
1001358364 5:171055185-171055207 TATTCTAATTCTGGACAAACAGG - Intronic
1002857366 6:1050283-1050305 AATTGAATTGGAGGACAATCAGG - Intergenic
1003380480 6:5620460-5620482 TGTTCAAATGTAGGACAAGCTGG + Intronic
1004006236 6:11639784-11639806 TTTTCTAATGAAAAACAATCGGG - Intergenic
1007244131 6:40447885-40447907 GATTCTAATGGAGGAGAACAGGG - Intronic
1009373089 6:62932560-62932582 TATCCAAAAGGAGGACAATCAGG - Intergenic
1011709644 6:90039331-90039353 TGTCCCAATGGAGGACAATTTGG - Intronic
1012139123 6:95599530-95599552 TATTCTAATGGAGGACAATCTGG + Intronic
1012331018 6:97987727-97987749 TATTTGAAGGGAGGACATTCTGG - Intergenic
1014858507 6:126432663-126432685 CATTTTAATGGATGAGAATCAGG - Intergenic
1016786666 6:148018184-148018206 TCTTTTAATGGAGGATAACCTGG + Intergenic
1021111854 7:16704894-16704916 CACTCTGATGGAGGACAATAAGG + Intronic
1022866720 7:34429368-34429390 TATTCAAATGGAGAACACCCAGG - Intergenic
1024348997 7:48343817-48343839 TAGAGTAATGGAGGACAATGTGG - Intronic
1025278478 7:57606529-57606551 TAGTCTTTTGCAGGACAATCTGG - Intergenic
1027384265 7:77644832-77644854 AATTCTAGTGCAGGAGAATCTGG - Intergenic
1031891822 7:127303219-127303241 TATTCTAATGCTGGAAGATCTGG - Intergenic
1033712020 7:143957272-143957294 AATTCGATTGGAGGAAAATCAGG + Intergenic
1034217457 7:149419558-149419580 TATTCTGATGGAAGACAACAGGG + Intergenic
1036391972 8:8331391-8331413 TTTTCTAAAGGAGGAAACTCAGG - Intronic
1037384806 8:18326851-18326873 TCTTCTAATGGGGGACATCCAGG + Intergenic
1038469894 8:27806234-27806256 TATTCCTATTGAGGGCAATCAGG + Intronic
1046408270 8:113803565-113803587 TAATCTAATGGATCACAATAAGG - Intergenic
1047061365 8:121230469-121230491 TATTCTAAGGGAGGTAACTCAGG - Intergenic
1051393393 9:16590831-16590853 TATCCTAGTGGACGAAAATCTGG + Intronic
1055184827 9:73438450-73438472 TATTCTGATTGAGGGCAATTAGG + Intergenic
1058891980 9:109369206-109369228 CTTTGTAATTGAGGACAATCTGG + Intergenic
1060836861 9:126762314-126762336 TATTCTAATGGCTGACAATGTGG + Intergenic
1203629532 Un_KI270750v1:59075-59097 TACTCTTTTGCAGGACAATCTGG - Intergenic
1187051366 X:15699284-15699306 AATTCTAAAGGAGGAAAATAAGG + Intronic
1188398350 X:29714239-29714261 TTGTCTAATAGAAGACAATCAGG + Intronic
1189544759 X:42029911-42029933 TATTCTAATGGAAGTAACTCAGG - Intergenic
1189771290 X:44430256-44430278 TATTCTAGAGGAGGAAATTCAGG - Intergenic
1189890605 X:45598146-45598168 TATTCTGATTGATGACAATCAGG - Intergenic
1191130317 X:57001077-57001099 TACTCTAATGAAGGGCAAGCAGG - Intergenic
1191245892 X:58228067-58228089 CATTCTAATGGGAGAGAATCCGG + Intergenic
1197704452 X:129623688-129623710 TATTCAAAAGAAGGACATTCAGG + Intergenic
1198575617 X:138007273-138007295 CTTTCCAATGGAGGACAGTCAGG + Intergenic