ID: 1012140007

View in Genome Browser
Species Human (GRCh38)
Location 6:95614874-95614896
Sequence CAGGGAAAAGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012140007_1012140014 25 Left 1012140007 6:95614874-95614896 CCCTCCTCCTTCTCTTTTCCCTG No data
Right 1012140014 6:95614922-95614944 GTCACATAACCAGAAACCTAGGG No data
1012140007_1012140013 24 Left 1012140007 6:95614874-95614896 CCCTCCTCCTTCTCTTTTCCCTG No data
Right 1012140013 6:95614921-95614943 TGTCACATAACCAGAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012140007 Original CRISPR CAGGGAAAAGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr