ID: 1012143619

View in Genome Browser
Species Human (GRCh38)
Location 6:95653858-95653880
Sequence GGAATACTAATCAACTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012143617_1012143619 24 Left 1012143617 6:95653811-95653833 CCTTCAATAAGCAAATGGATAAA No data
Right 1012143619 6:95653858-95653880 GGAATACTAATCAACTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012143619 Original CRISPR GGAATACTAATCAACTATAA AGG Intergenic
No off target data available for this crispr