ID: 1012145808

View in Genome Browser
Species Human (GRCh38)
Location 6:95680379-95680401
Sequence GTACATAAACAGATAAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012145806_1012145808 16 Left 1012145806 6:95680340-95680362 CCAAACACAAAAGAATATAGAGT No data
Right 1012145808 6:95680379-95680401 GTACATAAACAGATAAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012145808 Original CRISPR GTACATAAACAGATAAAACT GGG Intergenic
No off target data available for this crispr