ID: 1012152018

View in Genome Browser
Species Human (GRCh38)
Location 6:95765868-95765890
Sequence TCAAAGTTATGCAACTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012152018_1012152019 -1 Left 1012152018 6:95765868-95765890 CCTGTCAAGTTGCATAACTTTGA No data
Right 1012152019 6:95765890-95765912 AACATGCTCCTACTTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012152018 Original CRISPR TCAAAGTTATGCAACTTGAC AGG (reversed) Intergenic
No off target data available for this crispr