ID: 1012164989

View in Genome Browser
Species Human (GRCh38)
Location 6:95937891-95937913
Sequence GCTCTTGGAAATGCGCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012164989_1012164994 6 Left 1012164989 6:95937891-95937913 CCTCTGCGCGCATTTCCAAGAGC No data
Right 1012164994 6:95937920-95937942 AGCATACAGCTTCAGGTATCAGG No data
1012164989_1012164992 -1 Left 1012164989 6:95937891-95937913 CCTCTGCGCGCATTTCCAAGAGC No data
Right 1012164992 6:95937913-95937935 CCCAGTAAGCATACAGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012164989 Original CRISPR GCTCTTGGAAATGCGCGCAG AGG (reversed) Intergenic
No off target data available for this crispr