ID: 1012165661

View in Genome Browser
Species Human (GRCh38)
Location 6:95948020-95948042
Sequence TTCCTTACTTTTTTTTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012165661_1012165668 12 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165668 6:95948055-95948077 GAAGAAGAAGGAGGAGGAGGAGG 0: 331
1: 1174
2: 3086
3: 9444
4: 17787
1012165661_1012165665 3 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165665 6:95948046-95948068 GAAGGAGAAGAAGAAGAAGGAGG 0: 18
1: 250
2: 1268
3: 4293
4: 10221
1012165661_1012165664 0 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165664 6:95948043-95948065 GAGGAAGGAGAAGAAGAAGAAGG 0: 5
1: 72
2: 724
3: 2254
4: 7716
1012165661_1012165666 6 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165666 6:95948049-95948071 GGAGAAGAAGAAGAAGGAGGAGG No data
1012165661_1012165673 28 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165673 6:95948071-95948093 GAGGAGGGGAAGTTGGAAGAGGG No data
1012165661_1012165671 21 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165671 6:95948064-95948086 GGAGGAGGAGGAGGGGAAGTTGG No data
1012165661_1012165672 27 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165672 6:95948070-95948092 GGAGGAGGGGAAGTTGGAAGAGG No data
1012165661_1012165667 9 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165667 6:95948052-95948074 GAAGAAGAAGAAGGAGGAGGAGG 0: 239
1: 1046
2: 2653
3: 5972
4: 14900
1012165661_1012165669 13 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG 0: 36
1: 155
2: 521
3: 2021
4: 6837
1012165661_1012165670 14 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165670 6:95948057-95948079 AGAAGAAGGAGGAGGAGGAGGGG 0: 36
1: 148
2: 762
3: 2201
4: 7038
1012165661_1012165674 29 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165674 6:95948072-95948094 AGGAGGGGAAGTTGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012165661 Original CRISPR TTCCTTACTTTTTTTTATTG TGG (reversed) Intergenic
No off target data available for this crispr