ID: 1012165669

View in Genome Browser
Species Human (GRCh38)
Location 6:95948056-95948078
Sequence AAGAAGAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012165661_1012165669 13 Left 1012165661 6:95948020-95948042 CCACAATAAAAAAAAGTAAGGAA No data
Right 1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG 0: 36
1: 155
2: 521
3: 2021
4: 6837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012165669 Original CRISPR AAGAAGAAGGAGGAGGAGGA GGG Intergenic
Too many off-targets to display for this crispr