ID: 1012168769

View in Genome Browser
Species Human (GRCh38)
Location 6:95991602-95991624
Sequence CCTTCCTGAGCCCATGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012168769_1012168772 26 Left 1012168769 6:95991602-95991624 CCACATTCATGGGCTCAGGAAGG 0: 1
1: 0
2: 2
3: 37
4: 222
Right 1012168772 6:95991651-95991673 CTGCAGCTGAAGACAGATCTCGG 0: 1
1: 0
2: 2
3: 27
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012168769 Original CRISPR CCTTCCTGAGCCCATGAATG TGG (reversed) Intergenic
900940671 1:5796600-5796622 CCTTCCTGAGTGCCTGAGTGTGG - Intergenic
902633815 1:17721859-17721881 CATTCCTGAGCCAATCACTGTGG + Intergenic
902711901 1:18246191-18246213 CCTCCCTGAGTCTGTGAATGAGG + Intronic
903904962 1:26678741-26678763 CCTCCCTGGTCCTATGAATGTGG + Intergenic
903983452 1:27206565-27206587 ACTTCCTCAGCCCAAGAATGAGG - Intergenic
904409903 1:30319152-30319174 CCTTCCTGTGCCCGTGAAGGGGG - Intergenic
904770525 1:32878679-32878701 CCTCCCTGAGACTATGCATGGGG - Intergenic
905027266 1:34859454-34859476 CGTTGATGAGGCCATGAATGAGG - Intronic
905670159 1:39786102-39786124 CCTCTCTGAGCCCATGAAACAGG + Intronic
906061740 1:42953457-42953479 CCTCTCTGAGCCCATGAATCTGG + Intronic
906287700 1:44598369-44598391 CCGTCCTGAGCCCCTAAATCAGG - Intronic
906692327 1:47800716-47800738 CCTTCCTGAGCCCCTGGATAGGG - Intronic
907358998 1:53899759-53899781 ACTGCTTGAGCCCAGGAATGAGG - Intronic
911157516 1:94651871-94651893 CTTTCCAGAGCCCAGGAATGAGG - Intergenic
911332339 1:96540040-96540062 TTTTCCTGAGTGCATGAATGAGG - Intergenic
911551391 1:99285863-99285885 CCTTCCAGAACCCAAAAATGTGG - Intronic
911871859 1:103108668-103108690 CCTCCCTCAGCCCAAGAATGAGG + Intergenic
912691912 1:111810987-111811009 CCTTCCTGAGGCCCTGAAGCTGG - Intronic
915295531 1:154918715-154918737 CATTCCTGAGCCCAGGAGTTTGG - Intergenic
918041713 1:180917635-180917657 CATGCCTGAGCCCAGGCATGTGG + Intronic
918575533 1:186054763-186054785 CCATCTTGAGACCATGAAGGAGG - Intronic
919047324 1:192469951-192469973 CTTACCTGAGCCCATTAAGGTGG - Intergenic
919430083 1:197481647-197481669 CCTTCCTGAGCCCTTGCTAGAGG + Intergenic
919895813 1:202009260-202009282 CCTTCTTGAGACCCTGAATGGGG - Exonic
920988015 1:210908718-210908740 TCTTCCTGATCACATAAATGAGG - Intronic
923914970 1:238491893-238491915 CCTTGCAGAGCCCATGGATGTGG - Intergenic
924711120 1:246530796-246530818 CCATCCTGAGCCATTGAAGGAGG + Intergenic
1062797426 10:354996-355018 CCTTCCTCAGCCTGTGAATATGG - Intronic
1063307805 10:4921977-4921999 CCTCCCAGAGCCTAGGAATGAGG - Intergenic
1063307812 10:4922004-4922026 CCTCCCAGAGCCTAGGAATGAGG - Intergenic
1063307819 10:4922031-4922053 CCTCCCAGAGCCTAGGAATGAGG - Intergenic
1063780928 10:9323173-9323195 CTGTCCTGAGCCCATGACAGAGG - Intergenic
1064176412 10:13079404-13079426 CCTTCCTTGGCTCATGCATGAGG - Intronic
1064297710 10:14093132-14093154 CCTTCCTGATCCCAGCAAGGTGG + Intronic
1064936285 10:20682538-20682560 ACTTCCTCAGGCCAGGAATGGGG - Intergenic
1067557505 10:47283023-47283045 CTTTCCTTAGCCCAGGACTGAGG + Intergenic
1069871732 10:71537109-71537131 CCTTCATGGGCCCATGGCTGAGG + Intronic
1070284797 10:75075082-75075104 GCTTCCTCAGCCCTTGACTGGGG - Intergenic
1070437098 10:76403983-76404005 CCTGCCTGAGCCCAGGGAAGAGG + Intronic
1070918802 10:80171267-80171289 CCATGCTGAGCCCATGACAGAGG + Intronic
1071574407 10:86715223-86715245 CCATACTGAGCTCAGGAATGGGG + Intronic
1073100746 10:101005363-101005385 CCTTCCTGAGCCCTCGGAAGTGG + Intronic
1074288932 10:112123873-112123895 CCTTACTGTGCCCTTGGATGGGG - Intergenic
1075012732 10:118888592-118888614 CCTTCCTGAGCCCCTCCCTGAGG + Intergenic
1077371611 11:2184776-2184798 CATTCCTAAGAACATGAATGTGG - Intergenic
1077563512 11:3281276-3281298 CCGTCCAGAGCCCATTGATGGGG + Intergenic
1077739131 11:4825790-4825812 GCTTCCAGGGACCATGAATGAGG + Intronic
1081429416 11:42959904-42959926 CCTTGCTGAGTTCATAAATGAGG - Intergenic
1081536419 11:43999776-43999798 CCTTCCTGATCCCATGTAGTAGG + Intergenic
1083082759 11:60110882-60110904 CCCTCCTTCCCCCATGAATGTGG - Intergenic
1083168886 11:60910286-60910308 CATTCCTGAGGCCATGAATGAGG + Intergenic
1083733934 11:64668947-64668969 CCATCCTGTGCCCCAGAATGGGG - Intronic
1083827273 11:65210880-65210902 CCTCCCTGGGCCCATGGTTGGGG + Intronic
1085222096 11:74883291-74883313 CCTTCCTGAGTCAAAGAAAGGGG - Intronic
1085800578 11:79585613-79585635 CCTCCCTGAGCCCATCACTGTGG - Intergenic
1088268384 11:108009100-108009122 TCTTCCTGAGCGCGTGCATGAGG + Exonic
1088969918 11:114764188-114764210 CCTTGCTGAGATCATAAATGGGG + Intergenic
1092798310 12:12136470-12136492 CTTTACTTAGCCCATGTATGAGG - Intronic
1094484077 12:30910141-30910163 TCTTCCTGAGCAGGTGAATGGGG + Intergenic
1096593643 12:52679847-52679869 CCTTCTTCAGCCCCTCAATGTGG - Exonic
1096957220 12:55538871-55538893 CCTCCCTGACTCCATGACTGTGG + Intergenic
1097690306 12:62728691-62728713 TCTCCCTGAGCCCAGGAAGGTGG - Intronic
1098068540 12:66646722-66646744 CTTTCCTTATCCCATCAATGGGG - Intronic
1100497011 12:95134880-95134902 GCTTCCTGAGCACTTGAATCTGG - Intronic
1102229229 12:111250845-111250867 CTTCCCAGAGCCCATGAAAGTGG + Intronic
1102393731 12:112570327-112570349 CGTTCCTGAGCCAATTAGTGTGG - Intergenic
1102809762 12:115814201-115814223 ACTCCCTGAAACCATGAATGTGG - Intergenic
1104146668 12:126040646-126040668 CCATCCTGAACCCATCACTGTGG + Intergenic
1104634180 12:130427405-130427427 CCCTGCAGAGCACATGAATGCGG + Intronic
1106385053 13:29276536-29276558 CCTTCCTGTGCCCATGCCAGCGG - Intronic
1108436830 13:50409211-50409233 CCTTCCTCAGCACAGGAAAGAGG - Intronic
1108730380 13:53229458-53229480 CCTTCCTGAACCCACAAGTGTGG - Intergenic
1109335936 13:60993744-60993766 CCTTCCTGTGCACAGAAATGGGG + Intergenic
1109829180 13:67763377-67763399 ACTTTCTGAGCCAAGGAATGGGG - Intergenic
1112038747 13:95524234-95524256 GCTTCTTGAGTCTATGAATGAGG + Intronic
1113785042 13:112998001-112998023 CCTGCGTGAGCCCATGTGTGCGG + Intronic
1114412262 14:22512212-22512234 CCTTCCACAGTCCATGGATGTGG - Intergenic
1114533595 14:23409892-23409914 TGTTCCTGAGCCCAGGAATGGGG - Intergenic
1115593202 14:34884334-34884356 GCTTCCAGGGGCCATGAATGTGG - Intergenic
1116282112 14:42922128-42922150 CCATTCTGAGCCTATAAATGTGG - Intergenic
1117249721 14:53924493-53924515 CCTTCCAGAGCACAAAAATGTGG - Intergenic
1120997307 14:90426520-90426542 CCCTCCTGAGCCCACGAACGGGG + Intergenic
1121234221 14:92380382-92380404 CCTGCCTGAAGCCAGGAATGCGG - Intronic
1121775662 14:96588891-96588913 CCTTCCTGAGGCCGTGAATGGGG + Intergenic
1123981271 15:25606786-25606808 CCTTCCAGAACCCAGGAGTGAGG - Intergenic
1126758214 15:51945194-51945216 ACTGCTTGAGCCCATGAATTCGG + Intronic
1127273456 15:57421835-57421857 CCTGCCTGAGATCATGAATATGG + Intronic
1130336209 15:82959187-82959209 GATTCCTGAGCCCATCACTGTGG + Intronic
1132115246 15:99131237-99131259 CCTTCCCGAGCGCATGAGGGAGG + Exonic
1132703617 16:1231928-1231950 CCGTCCTGGTTCCATGAATGAGG + Intergenic
1132704892 16:1239433-1239455 CCGTCCTGGTTCCATGAATGAGG - Intergenic
1132707901 16:1254467-1254489 CCGTCCTGGTTCCATGAATGAGG - Intergenic
1133983832 16:10653077-10653099 CCTTCCTGTTCCCATGAAGTTGG + Intronic
1134086682 16:11362185-11362207 CCTTCCTGAAACCCTGAAAGAGG + Intronic
1134621469 16:15692654-15692676 CCTGCCTCAGCCCCTGAAAGTGG + Intronic
1135435858 16:22426180-22426202 CCCTCCTGAGTCCATGGGTGGGG - Intronic
1136055927 16:27689545-27689567 TCTCCCTGAGCCCAGGAGTGCGG - Intronic
1136079517 16:27842568-27842590 CCTTCCTGAGACCTTGAACTTGG - Intronic
1136597321 16:31260290-31260312 CCTTGCACAGTCCATGAATGTGG - Intronic
1137037024 16:35576257-35576279 CCCTCCTGAGCCCTGGAGTGTGG + Intergenic
1138226258 16:55297924-55297946 CACTCCTGAGCCAATAAATGGGG + Intergenic
1139516914 16:67457723-67457745 CCTTGCTGAGCCCAGGAGTGGGG - Intronic
1140123545 16:72102979-72103001 CCTTCCTACGCTCAGGAATGAGG - Intronic
1142045067 16:87920010-87920032 CCCTCCTGAGTCCATGGATGGGG - Intronic
1143117637 17:4589666-4589688 CCTTTCTCACCCTATGAATGTGG + Intronic
1144103278 17:11962799-11962821 CCTTTGAGAGCTCATGAATGTGG - Intronic
1149240714 17:54645584-54645606 CCTTCCTGTGTCCATTATTGTGG - Intergenic
1151232960 17:72697814-72697836 CCTTCCTGAGCCCATCCACGTGG - Intronic
1151855487 17:76718612-76718634 CCTGACAGAGCCCAAGAATGAGG - Intronic
1152126645 17:78451093-78451115 GCCTCCTGAGCCCATGCAAGTGG + Intronic
1152459159 17:80432290-80432312 CCTGGCTGGGCCCAGGAATGAGG + Intronic
1152512554 17:80800116-80800138 CCTTCCAGAGGGCATGAAAGTGG - Intronic
1152574541 17:81134265-81134287 CCTTCCTGGGGCCATCAAGGTGG - Intronic
1152645541 17:81466967-81466989 CCTTCCTGGGCCGGTGAGTGCGG + Intergenic
1152743197 17:82027514-82027536 CCAACCTGAGCCCACGAGTGAGG + Intronic
1152799254 17:82323390-82323412 CCTTCCTGGGCTCAGGCATGAGG - Intronic
1153170628 18:2312017-2312039 CCTTCTTGACTCCATGACTGTGG - Intergenic
1153928682 18:9859004-9859026 ACTTCCTAAGCCCATGAATTGGG + Intronic
1155656530 18:28199700-28199722 CCTGGCTGAGCCCACAAATGGGG + Intergenic
1157147285 18:45176751-45176773 TCTTCCCTAGCCAATGAATGTGG + Intergenic
1157250477 18:46091723-46091745 CATTCCTCAGCCCATGTACGCGG + Exonic
1158444539 18:57507939-57507961 GCTTCCTGAGCACAAGAATGGGG + Intergenic
1158503868 18:58028724-58028746 CATTCCTGAACCCATCACTGTGG + Intergenic
1161654226 19:5503936-5503958 CCTTGTTAAGCCCATGACTGTGG - Intergenic
1161676229 19:5651609-5651631 CTTTCCTGAGCCCGTGAAGGTGG + Intronic
1162696749 19:12482658-12482680 CCTTCCTGAGGGCATAATTGTGG - Intronic
1163201943 19:15776053-15776075 CATTCCTGACCCCATGAATTTGG + Intergenic
1163218044 19:15895190-15895212 CTTTCCTGATCCCATGAAGTTGG + Intronic
1164523249 19:28994980-28995002 CCTTCATGTGCCAATGTATGAGG - Intergenic
1166518017 19:43461644-43461666 CCCTCCAGAGCCCACGACTGTGG - Exonic
1167580207 19:50336903-50336925 GCTTCCTGAGCCGATGGATGGGG - Intronic
1167742816 19:51334421-51334443 CCTCCCAGAACCCAGGAATGTGG + Intronic
925031256 2:651421-651443 CCATGCAGAGCCCATGCATGAGG - Intergenic
925152628 2:1625612-1625634 CCTTGCAGAGGCCAGGAATGTGG - Intergenic
926204328 2:10824440-10824462 CCTTCCTGAGCCAATAACTGTGG - Intronic
926679173 2:15650923-15650945 CCTTCTTGTGCCCATGTAGGAGG + Intergenic
926722037 2:15968086-15968108 CCTTCCTAGGCCCAGGAATTGGG - Intergenic
927250076 2:20989325-20989347 CCTTCCATAGCCCATGACTGGGG - Intergenic
928046653 2:27940975-27940997 ACTTCCTGAGCCCCTACATGAGG + Intronic
928235063 2:29532052-29532074 CCATCCTGAGTCCGTGGATGAGG - Exonic
929764201 2:44830823-44830845 CCTTCCTGTGCTCAACAATGAGG - Intergenic
930031636 2:47061531-47061553 AAGTCCTGAGCCCATGAATGAGG - Intronic
930263380 2:49172308-49172330 CGTTCATGAGGCCATGCATGGGG + Intergenic
930698898 2:54439618-54439640 CCCTGCTGACCCCCTGAATGTGG - Intergenic
931409058 2:62011322-62011344 CGTTCCTCAGCCCCTAAATGGGG + Intronic
932330986 2:70898166-70898188 TCTTCCAGGGCCCATGGATGAGG - Intergenic
933994756 2:87660059-87660081 CCTGCCTGAGCCCAGAAATGAGG - Intergenic
934489941 2:94755546-94755568 CCTTCCTGACCACCTGACTGCGG - Intergenic
934561991 2:95318170-95318192 CCTCCCTGGGCCCATGAGTGGGG - Intronic
936299099 2:111290854-111290876 CCTGCCTGAGCCCAGAAATGAGG + Intergenic
936596747 2:113855343-113855365 CCCTCCTGACCCAATGAGTGTGG - Intergenic
937782797 2:125858618-125858640 GCTTCCTGAGCCTGTGAATGAGG + Intergenic
938230138 2:129651293-129651315 CCTTCCACAGCCAAGGAATGTGG + Intergenic
941180621 2:162254907-162254929 CCTTCCTGGGGCTATGAATATGG - Intergenic
944506693 2:200419624-200419646 CCTTCCTGAAGCCAGGATTGGGG + Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946062803 2:216959338-216959360 TATTCCTGAGCCCAAGAATAGGG - Intergenic
946202102 2:218076429-218076451 CCTTCCGGAGCCCAAGTCTGAGG - Exonic
948250970 2:236528745-236528767 CCTTTCTGACCCCATCAGTGGGG + Intergenic
948758521 2:240174141-240174163 CCTTCCTGTCAGCATGAATGAGG - Intergenic
1170116507 20:12865891-12865913 TCTTCCTGCTCCCATGTATGGGG - Intergenic
1172697573 20:36833049-36833071 CCTTTCTGAGCCTCAGAATGGGG - Intronic
1173116378 20:40247528-40247550 CCTTCCTGTGCAAATGCATGTGG - Intergenic
1173576685 20:44116469-44116491 GCCGACTGAGCCCATGAATGAGG - Intronic
1173932838 20:46835999-46836021 CCTTCCTGTCCCCATGAAGATGG - Intergenic
1174093278 20:48067038-48067060 CATTCCTGAGCCAATCATTGTGG - Intergenic
1175331250 20:58166032-58166054 CCTTCCTGAACCCATCAGTGTGG + Intergenic
1175941640 20:62540041-62540063 CCTCCTTGGGCCCAGGAATGGGG + Intergenic
1177924103 21:27192350-27192372 CCTTCATAAGCCCACCAATGTGG - Intergenic
1178346893 21:31837005-31837027 CATTTCTGAGCCCTTGAATTTGG - Intergenic
1179613787 21:42568972-42568994 CTTCCCTGAGCCCTTGTATGGGG + Intronic
1181418027 22:22774173-22774195 CCTGCCTGAGGTCATGACTGAGG + Intronic
1181582244 22:23834813-23834835 CCTTCCTGAGGCCAAGCAAGGGG - Exonic
1181616617 22:24059346-24059368 CCTACCAGATTCCATGAATGTGG - Exonic
1183743897 22:39682507-39682529 CCCACCTGAGCCCATGCGTGTGG + Exonic
1183892663 22:40942969-40942991 TCTTCTTGAGCCCATTAATATGG + Intergenic
1184068117 22:42131662-42131684 CCGGCCAGAGCCCAGGAATGTGG - Intergenic
1184424340 22:44400418-44400440 CCATCCTGAGCCAAGGACTGGGG - Intergenic
1184761813 22:46549171-46549193 GCTTCCTGAGGCCAAGACTGGGG + Intergenic
1185086466 22:48743582-48743604 CATTCCTGAGCTCATGGAGGAGG + Intronic
949498301 3:4654502-4654524 CCTTCTTCAACCCATAAATGTGG - Intronic
950471467 3:13189206-13189228 CCTTCCTGTGCCCATGACATTGG + Intergenic
951576276 3:24117471-24117493 CATTCCTGAGCCAATCACTGTGG - Exonic
953006189 3:38981572-38981594 CTTTCCTGAGACCACGGATGAGG - Intergenic
954108353 3:48421019-48421041 ATATCCTGAGCCCTTGAATGGGG + Intronic
955047899 3:55377153-55377175 CATTCCTGAGCCAATTACTGAGG + Intergenic
960708841 3:120507085-120507107 TCTTCCTTTGCCCACGAATGGGG - Intergenic
963179284 3:142337179-142337201 CCTTCCTGAGCCCTTTATTAGGG + Intronic
966885587 3:184376315-184376337 CCTTCCTGGGGCCATGGAGGCGG + Exonic
967426876 3:189337731-189337753 CTGTCCTGAGCCTATGAAGGTGG - Intergenic
967506585 3:190259548-190259570 GCCTCCTGAGACCATCAATGTGG + Intergenic
967631095 3:191743491-191743513 CCTTCCTCAGCTCATGCACGAGG + Intergenic
969247850 4:5947186-5947208 GCTTCCTCATCTCATGAATGGGG - Intronic
969665726 4:8556438-8556460 GATTCCTGTGCCCATGAATGTGG + Intergenic
971241738 4:24895615-24895637 ACTGCCTGAGCCTGTGAATGAGG - Intronic
971585802 4:28404269-28404291 TCTTCCTTCACCCATGAATGTGG + Intergenic
976572159 4:86624999-86625021 CCTCACTAAGCCAATGAATGAGG + Intronic
976628363 4:87210833-87210855 CCTTCCTGAGCAGATGAACCTGG - Intronic
977061893 4:92270117-92270139 CCTTCCAAAGCCTATGACTGGGG + Intergenic
977555746 4:98485893-98485915 CCTTCCTCAGCAAATGAAGGTGG + Intronic
983091932 4:163514346-163514368 CCATCCTGATCCCAAGAAAGTGG - Intronic
983147993 4:164241839-164241861 CCTTTCTGAGCCAAAGAAAGGGG + Intronic
984479605 4:180282660-180282682 CCTTCCTGTGTCCATGAATATGG - Intergenic
984620466 4:181946454-181946476 CCTCCCAGAGCCCCTGAAAGTGG + Intergenic
985550867 5:532959-532981 CTTTGCTCAGCCCATGAATGGGG - Intergenic
985852251 5:2397398-2397420 CCCTCCTGAAACCATGAATGGGG + Intergenic
986441140 5:7782858-7782880 CCTCTCTGAGCCTATGACTGCGG - Intronic
989196030 5:38717216-38717238 CATTCCTGAGCCCACAAATTTGG - Intergenic
990198714 5:53347416-53347438 ACTTCCTCAGCCCTTGAATCTGG + Intergenic
991645834 5:68799562-68799584 CCTTCCTGAACCCAGGCCTGGGG + Intergenic
992879941 5:81097834-81097856 CCTTTCTAAGCCAATGAAAGGGG + Intronic
992942320 5:81774570-81774592 AGTTCCTGAACCCATCAATGTGG + Intergenic
996594056 5:125181392-125181414 TCTTCCTGGGCTCAAGAATGAGG + Intergenic
997352589 5:133241614-133241636 CAGGCCTGAGCCCTTGAATGGGG + Intronic
997642242 5:135456813-135456835 CCTCCCTGAGCACATGATGGGGG - Intergenic
997871941 5:137514016-137514038 CCATCCTGAACCAATGACTGTGG - Intronic
998380654 5:141722885-141722907 CCATCCTGAGCCCATCATTGTGG + Intergenic
1003876553 6:10442933-10442955 ATTTGCTGAGTCCATGAATGTGG + Intergenic
1006725017 6:36192933-36192955 CCATCCTGAGCCAATAACTGTGG - Intergenic
1010896609 6:81372369-81372391 CATTCCTCAGCCCATAAGTGTGG - Intergenic
1011407308 6:87029587-87029609 CCTTCCTCATCTCATAAATGTGG - Intergenic
1012168769 6:95991602-95991624 CCTTCCTGAGCCCATGAATGTGG - Intergenic
1012719354 6:102722329-102722351 CCTTTCTGAGTCCAAGAAAGGGG + Intergenic
1016970610 6:149758764-149758786 CCTTCCTCTGCCAATCAATGGGG - Intronic
1017017921 6:150116468-150116490 CCTTATTGACACCATGAATGGGG - Intergenic
1017033951 6:150250543-150250565 TCTTTCTCAGCCCAAGAATGTGG - Intergenic
1019807730 7:3140854-3140876 TCTTCCTGTGCCCATGCATGGGG + Exonic
1022685439 7:32591959-32591981 CATTCCTGAGAGCATGAATGTGG - Intergenic
1024030413 7:45455771-45455793 GCCTCCTGAGCCCATGCATCAGG - Intergenic
1024204892 7:47149568-47149590 CCTTCCTGACACCAGGGATGGGG - Intergenic
1027943908 7:84722062-84722084 CCTTCCTGAGACCCTGACTAGGG - Intergenic
1028988496 7:97025857-97025879 CCCTCCTGGCTCCATGAATGTGG + Intergenic
1029726423 7:102408654-102408676 GCTTCCTGAGTGCATGATTGTGG + Intronic
1034156672 7:148961273-148961295 CCTTCCTCTGCCCTGGAATGAGG - Intergenic
1034235936 7:149569544-149569566 CCTTCCTTGGCTCATGCATGAGG - Intergenic
1035123884 7:156593345-156593367 ACTTGCTGTGCCCATGAACGAGG - Intergenic
1035244068 7:157550992-157551014 CCCTCCTGCGGCCATGACTGTGG + Intronic
1040809673 8:51438186-51438208 ACATCCTGTGCTCATGAATGGGG + Intronic
1041335667 8:56779783-56779805 CTTTCCTGAGCCATCGAATGAGG - Intergenic
1043573548 8:81631137-81631159 GCTTCTTAAGCCCATCAATGAGG + Intergenic
1045318575 8:101064013-101064035 CTTCCCTGAGCCCCTGAATGAGG - Intergenic
1047795536 8:128251456-128251478 CCTCCCTGACCCCAAGACTGTGG + Intergenic
1049418550 8:142506477-142506499 CCCTCCTGAGCCCAGGCCTGAGG - Intronic
1050274366 9:3981493-3981515 CCTCCCTGACCCCATGAGTCCGG + Intronic
1051334766 9:16055744-16055766 CCTTCCTGAGCCCCTGAACTTGG - Intronic
1055040904 9:71871079-71871101 GCTACCTGAGCTAATGAATGTGG + Intronic
1055279196 9:74655247-74655269 TCTTCCTGAGACCACGGATGAGG - Intronic
1056735493 9:89206155-89206177 CTTTCCTGAGCCTTTGGATGTGG - Intergenic
1056873130 9:90303735-90303757 CTTTCCTGAGCACTTGGATGTGG - Intergenic
1057739536 9:97699458-97699480 ACCTCCGGAGCCCATGGATGTGG - Intergenic
1059564265 9:115367231-115367253 CCTTTCTGTGCCCATAGATGAGG - Intronic
1061723012 9:132565284-132565306 CCTTCCTGAGCCCCAGATGGAGG + Intronic
1062185879 9:135218170-135218192 CCTTTCTTGGCCCAGGAATGGGG - Intergenic
1186927963 X:14356094-14356116 CCCCTTTGAGCCCATGAATGAGG - Intergenic
1188844359 X:35055223-35055245 CATTCCATAGCCCATGAATCAGG - Intergenic
1191656327 X:63602979-63603001 CCTTTCTGAGCCAAAGAAAGGGG - Intergenic
1192316312 X:70054516-70054538 ACTTCGTGAGCCACTGAATGGGG - Intergenic
1192784200 X:74321728-74321750 CATTCCTGAGCCCATGAGATGGG + Intergenic
1198032745 X:132769392-132769414 CCTTCTGGAGCCCATGCATTGGG - Intronic
1199906910 X:152241784-152241806 CCTTTCTGAGTCCAAGAAAGGGG - Intronic
1200306076 X:155027110-155027132 CCTTCCGGAGCCCAGGAAGGCGG - Intronic
1201473932 Y:14360957-14360979 CATACCTGAGACAATGAATGTGG + Intergenic