ID: 1012171757

View in Genome Browser
Species Human (GRCh38)
Location 6:96024976-96024998
Sequence TGGATCTAAGGTTGGCACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012171752_1012171757 7 Left 1012171752 6:96024946-96024968 CCTTTGATAGATTTTCTCATTAC No data
Right 1012171757 6:96024976-96024998 TGGATCTAAGGTTGGCACGAAGG No data
1012171750_1012171757 20 Left 1012171750 6:96024933-96024955 CCCACTGCAAAAACCTTTGATAG No data
Right 1012171757 6:96024976-96024998 TGGATCTAAGGTTGGCACGAAGG No data
1012171751_1012171757 19 Left 1012171751 6:96024934-96024956 CCACTGCAAAAACCTTTGATAGA 0: 1
1: 0
2: 1
3: 16
4: 151
Right 1012171757 6:96024976-96024998 TGGATCTAAGGTTGGCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012171757 Original CRISPR TGGATCTAAGGTTGGCACGA AGG Intronic