ID: 1012172659

View in Genome Browser
Species Human (GRCh38)
Location 6:96038606-96038628
Sequence GCAGCTGGTGGGAAACATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012172659_1012172664 10 Left 1012172659 6:96038606-96038628 CCAATATGTTTCCCACCAGCTGC 0: 1
1: 0
2: 1
3: 14
4: 167
Right 1012172664 6:96038639-96038661 TTTAAAATGCAAATCTGACTAGG 0: 1
1: 1
2: 15
3: 121
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012172659 Original CRISPR GCAGCTGGTGGGAAACATAT TGG (reversed) Intronic
901815395 1:11790730-11790752 GCAGGTGGTGGAAGACACATTGG - Exonic
905848633 1:41256925-41256947 GCAACTGTTAGGAAACATAGGGG - Intergenic
909651627 1:77982210-77982232 GTAGCTGTTTGGAAACATCTAGG - Intronic
909775518 1:79479791-79479813 CCAGCTGGTCAGAAACACATTGG + Intergenic
913135606 1:115885562-115885584 GCAGCTGGAGGGAAATCTTTGGG - Intergenic
913596640 1:120385090-120385112 GCAGCTGATGGGACGCAAATGGG + Intergenic
914090630 1:144493892-144493914 GCAGCTGATGGGACGCAAATGGG - Intergenic
914307977 1:146440331-146440353 GCAGCTGATGGGACGCAAATGGG + Intergenic
914594131 1:149132802-149132824 GCAGCTGATGGGACGCAAATGGG - Intergenic
915842894 1:159230684-159230706 GCACCTGGTGTGAAGCCTATAGG - Intergenic
917064933 1:171082102-171082124 ACAGCTGGTAAGAAAAATATTGG - Intergenic
921691671 1:218158032-218158054 GGAGCTGTTGGAAAACATCTTGG + Intergenic
924626471 1:245699905-245699927 GCAGCTGGTTGAAAAGATATTGG + Intronic
1066611728 10:37255717-37255739 GCAGCTGGTGGCCATCATATTGG + Intronic
1069438283 10:68406483-68406505 GCAGCTGCTGGGAGGCAGATCGG + Intronic
1070481166 10:76884186-76884208 GCAGCTGGCAGGAAAGATTTGGG + Intronic
1072297087 10:94019597-94019619 GTGGCTAGTGGCAAACATATTGG - Intronic
1075986077 10:126786531-126786553 GCAGCTGGCGGGCTCCATATTGG + Intergenic
1078615086 11:12857300-12857322 GCAGCCGGTGGGAAAGACAAGGG + Intronic
1078920801 11:15828608-15828630 GCAGCTGGTCGGCAAATTATTGG - Intergenic
1080834140 11:35924649-35924671 GTAGCTAGTGGCTAACATATTGG - Intergenic
1082175696 11:49056363-49056385 GCAGGATGTGGGAAATATATCGG - Exonic
1082942039 11:58716364-58716386 GCAGCAGGAGGGAAATATACTGG - Intronic
1083002702 11:59310164-59310186 GCAGAGGGTGGGAAACATGATGG + Intergenic
1083538601 11:63494745-63494767 AAAGGTGGTGGCAAACATATAGG - Intergenic
1086690043 11:89779702-89779724 GCAGCATGTGGGAAATGTATCGG + Intergenic
1086715811 11:90060253-90060275 GCAGCATGTGGGAAATGTATCGG - Intergenic
1087412102 11:97805016-97805038 GCAATTTGTGTGAAACATATAGG - Intergenic
1088643867 11:111900125-111900147 GCACCTGTTTGGATACATATTGG + Intergenic
1090836397 11:130457361-130457383 GCAGCTGGTGGGAATCGTGGTGG + Intronic
1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG + Intronic
1095893520 12:47257638-47257660 GCAGCTGGTGGAAAACCTTAAGG + Intergenic
1101603587 12:106231481-106231503 GCAGCTGGGAGGAGACATACAGG - Intergenic
1102083766 12:110119378-110119400 GCTTCTGGTGAGAAACAGATTGG + Intergenic
1103420032 12:120773302-120773324 GCAGCAGGTGGGAAGCCCATCGG + Intronic
1105226515 13:18439590-18439612 GCAGCTGGTGGCTATCATACTGG + Intergenic
1106014609 13:25856833-25856855 GCAGCTGGTGATTACCATATTGG + Intronic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1106845770 13:33736357-33736379 ACAGCTGATGGTAAACCTATGGG - Intergenic
1107085119 13:36419269-36419291 GCAGCTAGTGGCTACCATATTGG - Intergenic
1109225510 13:59689675-59689697 GCAGACGGTGGGGAACAAATTGG + Intronic
1110034946 13:70672141-70672163 GCAACTGTGGGGAAACATAGAGG - Intergenic
1110474865 13:75902132-75902154 GCAGCTGGAGGGAAAGCTCTAGG + Intergenic
1111588538 13:90312670-90312692 GAAGCTGGTGGGGCACATTTGGG + Intergenic
1114010968 14:18368093-18368115 GCAGCTGGTGGCTATCATACTGG + Intergenic
1115977161 14:39009365-39009387 GCAGCTGGAAAGAAACATTTGGG - Intergenic
1121198792 14:92099299-92099321 TCAGCTGGTGAAAAAAATATGGG + Intronic
1124996662 15:34729688-34729710 GTAGCTGGTGGCTACCATATTGG - Intergenic
1125344510 15:38705511-38705533 GCAGATGGTGGGAAATCTAGAGG + Intergenic
1127720249 15:61692115-61692137 ACAGCAGGTAGGAAACTTATGGG + Intergenic
1134042607 16:11080058-11080080 GTTTCTGGTGGGAAACAGATGGG - Intronic
1137715284 16:50594772-50594794 GCTGCTGGTGGGGAGCACATAGG + Intronic
1139656216 16:68388600-68388622 GCAGCTGGTGGGGGACAGTTTGG - Intronic
1140257776 16:73351507-73351529 GCAGCTGGGGGGAAAGAAACAGG - Intergenic
1140326409 16:74007127-74007149 GTGGCTTGTGGGAACCATATGGG - Intergenic
1140618769 16:76701243-76701265 GCAACTGGTGGCTAATATATTGG + Intergenic
1140720150 16:77764276-77764298 GCAGCTGGTGGGGAGTATACAGG + Intergenic
1147539514 17:41345468-41345490 GAAGGTGGTGGGAAACAGAATGG - Intergenic
1148987020 17:51631794-51631816 GCAGCTAGTGGCCACCATATTGG - Intronic
1152740256 17:82015586-82015608 GCAGCAGGTGGGATGCAGATGGG + Intronic
1154526870 18:15299890-15299912 GCAGCTGGTGGCTATCATACTGG - Intergenic
1157848709 18:51028239-51028261 CCAGGAGGTGGGAATCATATGGG - Intronic
1158739648 18:60125613-60125635 GCAGCTGGAAAGAAACATTTGGG + Intergenic
1159793774 18:72816968-72816990 GCAGCCTGTGGGAGGCATATGGG + Intronic
1163918522 19:20265384-20265406 GGACCTGGTGGGACACATTTGGG - Intergenic
1165103232 19:33452127-33452149 GCAGCTGGTGTGAATCTTTTTGG - Intronic
1166706912 19:44913121-44913143 GCAGCTGGTGGGGAAGGCATTGG + Intergenic
1166709084 19:44925676-44925698 GCAGCTGGTGGGGAAGGAATTGG + Intergenic
925605339 2:5654459-5654481 GCAGCTGATGGGATGCAAATGGG + Intergenic
928813848 2:35264719-35264741 GCAGCTAGAGGGAAAAATAAAGG - Intergenic
928929776 2:36612054-36612076 GCAGGGGGTGGGAACCATCTCGG - Intronic
931132572 2:59353688-59353710 GCAGCTGATGTGAAACATTCTGG + Intergenic
933818605 2:86089299-86089321 GCAGCAGATGGGAATCATCTGGG + Intronic
935987554 2:108689268-108689290 GCAGATGGTGGAAACCATATTGG + Intergenic
936126380 2:109791965-109791987 GCAGATGGTGGAAACCATATTGG + Intergenic
936218313 2:110579503-110579525 GCAGATGGTGGAAACCATATTGG - Intergenic
936714972 2:115175716-115175738 GTAGCTGGTGGTTATCATATTGG - Intronic
937366999 2:121270153-121270175 GTAACTGGTGGGGAAAATATAGG - Intronic
937855031 2:126666105-126666127 GCAGCTGCTGGGACACAGGTGGG - Intronic
938454523 2:131450337-131450359 GCAGCTGTTTGGAAAGCTATTGG + Intergenic
938525967 2:132131247-132131269 GCAGCTGGTGGCTATCATACTGG - Intergenic
941453164 2:165684205-165684227 GCAGCAGGTGGAAAACAGAGAGG + Exonic
943043474 2:182830228-182830250 TCTGGTGGTGGGAAACATAGGGG + Intergenic
944439651 2:199728993-199729015 GCAGCTGTTGTCAAAAATATGGG + Intergenic
947779447 2:232744390-232744412 GAAACTGTTGGGAAACATGTTGG + Intronic
948042073 2:234910393-234910415 GCAGCTGGTGGTTAACACCTTGG - Intergenic
948395047 2:237639222-237639244 GGAGCTTGTGAGAAAAATATAGG + Intronic
1169848356 20:10021590-10021612 GCAGCTGGGAGGAAACACACTGG + Intronic
1170137433 20:13090054-13090076 GTAGCTGGTGGCTACCATATAGG + Intronic
1170598109 20:17820667-17820689 GCTGTTGGTGGGAGACACATGGG + Intergenic
1172623655 20:36335309-36335331 GGAGCTGGTGGGACACACCTGGG + Intronic
1173280149 20:41619714-41619736 GCAGTTTGTGGGATACATTTAGG + Intergenic
1173487050 20:43448651-43448673 GCACCTGGTGGGAGACAATTGGG - Intergenic
1176770566 21:13068615-13068637 GCAGCTGGTGGCTATCATACTGG + Intergenic
1178086905 21:29121273-29121295 GCAGCTGGTGGCCAACTCATGGG + Intronic
1180435462 22:15298897-15298919 GCAGCTGGTGGCTATCATACTGG + Intergenic
1180517658 22:16162708-16162730 GCAGCTGGTGGCTATCATACTGG + Intergenic
1181135294 22:20761560-20761582 GCTGCTGGAGTGAAAAATATGGG - Intronic
949278478 3:2317684-2317706 GCAGCTGCTGTGAAAGAAATTGG + Intronic
950410816 3:12835521-12835543 GCAGCTGGTGGGAGGGTTATAGG + Exonic
950765959 3:15273115-15273137 GGAGTTGGTGTGAAGCATATAGG - Intronic
961130056 3:124457781-124457803 GAAGCTGGTGAGAGACATAATGG - Intronic
966014531 3:175125228-175125250 GTAGCTGGTGGTTAACATACTGG + Intronic
966849164 3:184154319-184154341 TCAGCTGGAGGGAAGCACATAGG - Intronic
968710811 4:2115947-2115969 GCAGCTGGTCTGAAACACATGGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968999215 4:3966514-3966536 GCAGAGGGTGGGAAACATTTAGG + Intergenic
969754788 4:9142117-9142139 GCGGAGGGTGGGAAACATTTAGG - Intergenic
971312189 4:25534959-25534981 GCAACTGGTGGAAAACAGAGTGG + Intergenic
973115502 4:46452778-46452800 ACTGCTGGTGAGATACATATAGG - Intronic
975182170 4:71358666-71358688 GCTGCTGATGGGAAATATTTTGG + Intronic
976599833 4:86927995-86928017 GCAGCTGGGTGGAAAGAGATGGG + Intronic
977073411 4:92422193-92422215 GCAGCAGGTGGGAAAAAGCTTGG + Intronic
978467925 4:109029097-109029119 ACAGCATCTGGGAAACATATGGG + Intronic
980084196 4:128374703-128374725 GCATCTGGTGGGTACCATTTTGG + Intergenic
980642818 4:135601958-135601980 GCAGCTTGTAGGAAACAAAAAGG + Intergenic
982542146 4:156687213-156687235 GCAAAGGATGGGAAACATATTGG + Intergenic
985913412 5:2899958-2899980 ACAGCTGGTGGGCAAGTTATAGG - Intergenic
987097220 5:14560703-14560725 TGAGCTGGTGAGAAACACATGGG + Intergenic
987691654 5:21274727-21274749 GAAGCTGGAGGGAAACACTTAGG + Intergenic
991312193 5:65256131-65256153 GTGGCTGGTGGCAACCATATAGG - Intronic
991748723 5:69775410-69775432 GAAGCTGGAGGGAAACACTTAGG - Intergenic
991800301 5:70355222-70355244 GAAGCTGGAGGGAAACACTTAGG - Intergenic
991828299 5:70654819-70654841 GAAGCTGGAGGGAAACACTTAGG + Intergenic
991892659 5:71354662-71354684 GAAGCTGGAGGGAAACACTTAGG - Intergenic
993427111 5:87780234-87780256 GCTGTTGGTGGGAAACTAATAGG - Intergenic
995434261 5:112118304-112118326 GAAGCTAGTGGGAAAAATTTGGG - Intergenic
998908559 5:146933189-146933211 TCATCTGGTTGGAAACACATGGG - Intronic
999712319 5:154329553-154329575 GCAGCTAGAGGGAAACATAAGGG - Exonic
1003760881 6:9177486-9177508 GCACCTGGATGGAAACATTTGGG - Intergenic
1004410270 6:15375124-15375146 TAAGGTGGTGGGAAACAAATTGG - Intronic
1005350626 6:24931423-24931445 ACAGCTGGTTGGAAAAAAATTGG - Intronic
1006061019 6:31419313-31419335 TCATCTGTTGGTAAACATATAGG + Intergenic
1006995375 6:38254829-38254851 GCAGCTGCTGTGAAAAATTTTGG + Intronic
1007277840 6:40688775-40688797 GCAGCTGTAGGGATAGATATGGG - Intergenic
1007652649 6:43432853-43432875 GAAGCTGGTGGGGACCATGTTGG + Exonic
1009311108 6:62153908-62153930 GCAGGTGGTGGATAACATAGTGG - Intronic
1010599791 6:77810112-77810134 TCTGATGGTGGGCAACATATAGG - Intronic
1012172659 6:96038606-96038628 GCAGCTGGTGGGAAACATATTGG - Intronic
1013943205 6:115691019-115691041 GCAGAGGGTGGTAAACATAATGG + Intergenic
1015494286 6:133864805-133864827 GCAGCTGTGAGGAAACATAGGGG - Intergenic
1016862457 6:148734521-148734543 GCAGCAGCTGGGAAGCTTATAGG - Intergenic
1017289742 6:152722114-152722136 GCTGATGGTGGGAGAGATATTGG - Exonic
1018074413 6:160198808-160198830 GCAGCTGGTGGATAACATTCTGG + Intronic
1022403965 7:30069185-30069207 GAGGCTGGTGGGAAACAGATAGG - Intronic
1024676170 7:51639557-51639579 GCGGCTGGTGGCTACCATATTGG - Intergenic
1028624797 7:92865349-92865371 GCAACTTGTGGCAAATATATCGG - Intergenic
1029024476 7:97401500-97401522 GCCTCTTGTGGGAAACAAATAGG + Intergenic
1029253666 7:99254433-99254455 GCAGCAGGTGGCAGACATAAAGG - Intergenic
1031984758 7:128156750-128156772 GCAGCTAGTGGCTACCATATAGG + Intergenic
1034374429 7:150630015-150630037 GGAGCAAGTGGGAAACATTTGGG - Intronic
1034402057 7:150868847-150868869 GAAGCTGGTGGGAAGCACAGGGG - Intergenic
1034813320 7:154151173-154151195 CCGGCAGGTGGGACACATATTGG - Intronic
1035657138 8:1318814-1318836 GCAGCTGTTGGGGAACACATTGG - Intergenic
1036378022 8:8217433-8217455 GCGGAGGGTGGGAAACATTTAGG - Intergenic
1037783147 8:21885109-21885131 GCAGCTGGAGGGAAGGAAATGGG + Intergenic
1039647121 8:39299123-39299145 GCAGCTAGTGGGAAACTGAATGG - Intergenic
1043040655 8:75258906-75258928 GCAGATGGTGGGAAAGAAAGAGG + Intergenic
1043358469 8:79441450-79441472 GCTGCTGATGGGAAACAGATCGG + Intergenic
1044807446 8:96022635-96022657 GTAGCTGGTGGCTACCATATTGG + Intergenic
1045707835 8:104947189-104947211 CCAGCTGAAGAGAAACATATGGG - Intronic
1046772631 8:118131579-118131601 TGAGCTGGGGGGAAACATACTGG - Intergenic
1046787479 8:118283732-118283754 GCAGATGGAGGGAAACAGAATGG + Intronic
1047977284 8:130142887-130142909 GCAGTTGGTGGGAAAGGTAGAGG + Intronic
1049125221 8:140780453-140780475 GCAGCTGATGGGAAATAAACGGG + Intronic
1052983714 9:34469027-34469049 GAACTTGGTGGAAAACATATAGG + Intronic
1054414734 9:64862202-64862224 GCAGCTGGTGGCTATCATACGGG - Intergenic
1055392910 9:75842599-75842621 GAGGCTGGTGGCCAACATATTGG + Intergenic
1055650085 9:78398581-78398603 GCAGGTGGTGAGAAAGATCTTGG - Intergenic
1056261705 9:84855219-84855241 GCAGCTCATGGGAAACAGATTGG + Intronic
1056282475 9:85055346-85055368 GAAGGTGGTGGGAAACACAAAGG + Intergenic
1057770158 9:97960391-97960413 GCAGCTAGTGGCTACCATATTGG + Intergenic
1186290803 X:8096543-8096565 GCAGCTGGTGTCAGAAATATTGG - Intergenic
1186408592 X:9325693-9325715 ACAGCAGGTGTGAAACATATAGG + Intergenic
1186684816 X:11914744-11914766 GCAGCTGTGGCTAAACATATGGG + Intergenic
1192552049 X:72062439-72062461 ACAGCTGGTGGGAAGCAAACTGG + Intergenic
1192558628 X:72110092-72110114 GAAGCTGGTGGAGAAAATATGGG - Intergenic
1194026944 X:88764339-88764361 TCAGATGGTGGGCACCATATGGG + Intergenic
1195927056 X:110036944-110036966 GTAGCTAGTGGTAACCATATGGG + Intronic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1196567073 X:117220691-117220713 GAAGCTTGTGGCTAACATATTGG - Intergenic
1196934656 X:120717564-120717586 GTAGGTGGAGGGAAAGATATGGG + Intergenic
1199791921 X:151162844-151162866 GCAGCTAGTGGCTACCATATTGG + Intergenic