ID: 1012173292

View in Genome Browser
Species Human (GRCh38)
Location 6:96046557-96046579
Sequence GTGTAGGTCTTCAGGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012173292_1012173296 -10 Left 1012173292 6:96046557-96046579 CCACCCATCCTGAAGACCTACAC 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1012173296 6:96046570-96046592 AGACCTACACCCTAACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012173292 Original CRISPR GTGTAGGTCTTCAGGATGGG TGG (reversed) Intronic
900457059 1:2781226-2781248 CTGTAGGACTTCAGTATGTGGGG + Intronic
910224528 1:84922928-84922950 GTGTAGGTCCTCAGCAGGAGTGG + Intergenic
913184698 1:116359552-116359574 GTGATGGTCTTCAGGGTGGTGGG - Intergenic
918519645 1:185401414-185401436 GAGTAGGTTTCCAGGAGGGGTGG + Intergenic
920219555 1:204386798-204386820 CTGTAGGGTTTCAGGATGGTCGG - Intergenic
920850783 1:209626773-209626795 GTGTAGGTCTGCAGCAGGGCAGG - Intronic
921450324 1:215297892-215297914 GTGTAGCCCTTCTGGATGTGTGG + Intergenic
923449939 1:234107062-234107084 ATGTGGGTCTGCAGGTTGGGAGG + Intronic
1063957583 10:11281012-11281034 GTGTGTGTGTTCAGAATGGGAGG + Intronic
1064174993 10:13067015-13067037 GTGTGGGGCTTGAGGAGGGGTGG + Intronic
1067549658 10:47225569-47225591 GAGGAGGTCTGCAGCATGGGCGG - Intergenic
1068183309 10:53551001-53551023 GTGTTGGACTTGAGGATGAGAGG - Intergenic
1069169437 10:65207236-65207258 GTGTAGGTCTTCACTCTGTGAGG + Intergenic
1069844243 10:71359639-71359661 CTGCAGGTCCTCAGGGTGGGAGG + Intronic
1075778887 10:125004516-125004538 GTGTGGGTCTTGAAGATGTGAGG - Intronic
1076383899 10:130043875-130043897 TTGTAGCTCGTCATGATGGGAGG + Intergenic
1077002974 11:334174-334196 GTGGTGGTCTTTGGGATGGGAGG - Intergenic
1078708615 11:13768758-13768780 GTGTGTGTGTTCTGGATGGGTGG + Intergenic
1079691442 11:23423201-23423223 GTGTACGTGTTCAGAATGGCTGG - Intergenic
1079792512 11:24755931-24755953 GTTAATGTCTTCAGGATTGGAGG - Intronic
1081771119 11:45651083-45651105 GCTTAGGTCTTCAGGGTGTGTGG - Intronic
1082079448 11:48000760-48000782 GAGTAGGTGATAAGGATGGGAGG - Intronic
1083350007 11:62020994-62021016 TTATAGGTCTTCAGGAAGAGAGG - Intergenic
1083839706 11:65297249-65297271 GTGCAGGTCGTCAGGATCTGAGG + Exonic
1084506739 11:69573080-69573102 ATGCAGGTCTCCAGGGTGGGGGG + Intergenic
1085942893 11:81226708-81226730 ATATAGATCTTCAGGATGTGCGG + Intergenic
1089194053 11:116681572-116681594 ATGGAGGTCTTCAGGAGGGATGG + Intergenic
1091444735 12:537821-537843 GTGGAGCTCTTCAGCCTGGGTGG + Intronic
1092413770 12:8274037-8274059 GTGTTTGTCTTGAGGATCGGCGG + Intergenic
1095306486 12:40644735-40644757 CTGTAGGTATTCAAGGTGGGAGG - Intergenic
1097189859 12:57214501-57214523 GTGTGGGGCTTCAGGATAGGCGG - Intergenic
1097897688 12:64841997-64842019 GTGTAGGTCTTCTGGTTGGTGGG + Intronic
1105057756 12:133118334-133118356 ATGTATGTCTTCAGGGTAGGTGG + Exonic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1112945468 13:104921433-104921455 GTCTAGGTCTTCAGCAAGGCTGG - Intergenic
1115528085 14:34301375-34301397 GAGTTGGTTTTCAGGATGTGTGG + Intronic
1118247455 14:64125161-64125183 GCGCAGGTCTTCAAGTTGGGTGG - Exonic
1118339559 14:64882668-64882690 GTGTAGGTTTTCAACATGGGTGG - Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1121169519 14:91841746-91841768 GTACAGGGCTTCAGGATGGCTGG + Intronic
1122499594 14:102187849-102187871 GGGTGGGGCTTAAGGATGGGAGG + Intronic
1128252333 15:66172022-66172044 TTTTAGGCCTGCAGGATGGGAGG + Intronic
1129882666 15:79017451-79017473 CTGTAGGTCTGCAGGATAGTGGG + Intronic
1132794486 16:1712712-1712734 CTGCAGGTCTGCAGAATGGGGGG - Intronic
1135950894 16:26913177-26913199 GTGTATGGGTACAGGATGGGTGG + Intergenic
1139532129 16:67547553-67547575 GGGTGGGACTTCAGGATGGCAGG + Intergenic
1139827295 16:69767192-69767214 GTTTAGGCCTCCAGGATGGATGG + Intronic
1141414402 16:83858993-83859015 GAGTAGGTATTCATGAGGGGAGG + Intergenic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1142174334 16:88638342-88638364 GTGTAGGTGCTCAGGTTGGGCGG + Intergenic
1144702038 17:17346457-17346479 GTGTAAGCCATCAGGATGGCAGG + Intronic
1146520553 17:33522297-33522319 ATGTAGGCCTTCAGGAACGGGGG - Intronic
1147327484 17:39676453-39676475 GCGTAGGGCCACAGGATGGGTGG + Intronic
1149512282 17:57253824-57253846 CTGGAGCTCTTCAGGAAGGGTGG + Intergenic
1150429605 17:65104623-65104645 CTCTAGGTCTTGAGGATGTGAGG + Intergenic
1153157492 18:2166234-2166256 GTGGGGGTCTTCAGAATGGTGGG + Intergenic
1155373682 18:25133004-25133026 GTGTTGGTCTGTTGGATGGGCGG + Intronic
1156034875 18:32754952-32754974 GTGTAGATCTGCAGCAAGGGAGG + Intronic
1159609490 18:70510096-70510118 GAGTGGATCTGCAGGATGGGTGG + Intergenic
1159820659 18:73138755-73138777 GTGTAGGTCTTTAGCAGGGTTGG - Intergenic
1162716304 19:12636633-12636655 GGGTAGGTCTTGGGGAGGGGAGG - Intronic
1162753578 19:12843657-12843679 GTGTGGGTCTTCAGGCTGGAGGG - Intronic
1162917419 19:13881784-13881806 GTGTAAGGCTGCAGGGTGGGAGG + Intergenic
1166262440 19:41650064-41650086 GTGTAGGTCAACAGTCTGGGTGG + Intronic
1167274072 19:48524774-48524796 TTGTAGGTCTTCAATTTGGGTGG - Intergenic
1167850035 19:52194414-52194436 GTGAAGGCCTTGAAGATGGGAGG + Intronic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
933598068 2:84302612-84302634 GTGTATGTGTACAGGATGGGAGG + Intergenic
934761649 2:96860025-96860047 GTGAATGTTTTCAGGGTGGGGGG - Exonic
937952964 2:127402359-127402381 CTGCAGGCCTGCAGGATGGGAGG - Intergenic
946149647 2:217755599-217755621 GTGTAGGTGTTCAGGAAGCTTGG - Intronic
946538491 2:220657856-220657878 GTGTGGGTCTTCAGGCTTGAGGG + Intergenic
1170615415 20:17945213-17945235 GTGTAGGTCTAGAGGAAGGCAGG - Intronic
1172102348 20:32492895-32492917 GTGTGGGTCTCCAGGGTGTGTGG + Intronic
1174147737 20:48463846-48463868 TTGTCTGTCTTCAGGATGGGTGG - Intergenic
1179587064 21:42380132-42380154 GTGCTGGACGTCAGGATGGGGGG - Exonic
1180101061 21:45586204-45586226 TTGCAGGTCTTCACGCTGGGAGG - Intergenic
1183112452 22:35660294-35660316 GTGTAGGTGTGCAGCAGGGGTGG - Exonic
1183246335 22:36696480-36696502 GTGTGGGTGTTCAGAAAGGGTGG - Intronic
1184755948 22:46515799-46515821 CTGGAGATCTGCAGGATGGGCGG - Intronic
1184860230 22:47169357-47169379 GTGTTGGTTCTCAGGATGGTGGG - Intronic
1185049552 22:48546665-48546687 GTGAGGGTCCGCAGGATGGGGGG + Intronic
954088236 3:48264054-48264076 GTGTACATCATCAGGAGGGGAGG + Intronic
954597678 3:51840707-51840729 GTTTCGGTCTTCACGATGGGAGG - Intergenic
954697967 3:52437457-52437479 GTCTTGGGGTTCAGGATGGGAGG + Intronic
961232054 3:125322994-125323016 GTATATGTGTTCAGGATAGGGGG + Intronic
962956354 3:140270541-140270563 GTGTGAGTCATCTGGATGGGAGG - Intronic
964720788 3:159765324-159765346 GTCTGGGTTTGCAGGATGGGCGG + Intronic
965251155 3:166345989-166346011 GTCTAGTTCTTCAAGATGCGTGG - Intergenic
967270028 3:187725560-187725582 GTGTGGGTTTTCAGGTTGGCTGG + Exonic
973705454 4:53576013-53576035 GTGTTGGGCTTCAGGCTGGTGGG - Intronic
973779973 4:54279231-54279253 ATGTGGCTCTTCAGGATGTGCGG + Intronic
975321898 4:73018139-73018161 GTGTAGGTGTTCAGGATACTTGG + Intergenic
981267226 4:142801266-142801288 GTGAATGTTTTTAGGATGGGAGG - Intronic
985576817 5:677467-677489 GTGTAGGGTTTCGGCATGGGAGG - Intronic
988412695 5:30907676-30907698 ATTCAGGTCTTTAGGATGGGAGG - Intergenic
992293981 5:75308832-75308854 GTGCAGGACTCCACGATGGGGGG + Intergenic
994056331 5:95420872-95420894 GTGTAGGTATTGAGAATGGCAGG + Intronic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
1001977188 5:176009768-176009790 CTGCAGGTCTTCAGGCTGGAGGG - Intronic
1002240237 5:177834012-177834034 CTGCAGGTCTTCAGGCTGGAGGG + Intergenic
1002632158 5:180589466-180589488 GTGTGGATATTCATGATGGGGGG + Intergenic
1005463204 6:26088084-26088106 GTGGAGGTCTCTAGGGTGGGAGG + Intronic
1008810709 6:55494207-55494229 GTTTAGGTCTTCAGGATAAAGGG - Intronic
1009044386 6:58220227-58220249 CTGTAGGTCTTCAAGATTTGAGG + Intergenic
1009220209 6:60974473-60974495 CTGTAGGTCTTCAAGATTTGAGG + Intergenic
1011002428 6:82606117-82606139 GGGTCAGTCATCAGGATGGGGGG + Intergenic
1012173292 6:96046557-96046579 GTGTAGGTCTTCAGGATGGGTGG - Intronic
1018291171 6:162293658-162293680 CTCTAGCTCTTCAGGCTGGGAGG - Intronic
1018795754 6:167184385-167184407 CTCTGGGTGTTCAGGATGGGTGG + Intronic
1024081649 7:45861611-45861633 GTTTAGATCTGCAGGGTGGGTGG - Intergenic
1026953736 7:74364078-74364100 GTGCAGGTCAGCAGGTTGGGAGG + Intronic
1027238548 7:76312536-76312558 GTCTATGTCTTCAGGCTGGTGGG + Intergenic
1028262578 7:88684153-88684175 GTGTTGGACTTCAGGCTGTGTGG + Intergenic
1035330414 7:158093224-158093246 GTGTGGGTCTACAGTGTGGGGGG - Intronic
1037750004 8:21675302-21675324 AAGTAGGTCATCAGGATGGACGG + Intergenic
1041081140 8:54215940-54215962 GAGTAGGTCTGCAGATTGGGAGG - Intergenic
1042334873 8:67619693-67619715 GTGGAGGTCTTCAGACTGGTTGG - Intronic
1045040459 8:98219093-98219115 GTTTAGGTTTCCAGTATGGGAGG + Intronic
1049602627 8:143514993-143515015 GTGTGTGTCTGCAGGATGGTGGG - Intronic
1049785355 8:144448221-144448243 CTGTGGGAGTTCAGGATGGGAGG - Intergenic
1051867043 9:21695074-21695096 GTGGAGGTCTGTAGAATGGGAGG + Intergenic
1055185493 9:73447634-73447656 CTGTAGGACTTAAGTATGGGTGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059250072 9:112880429-112880451 GTGAGGGTCTTCAGGCTGGTTGG - Intronic
1059347173 9:113636979-113637001 GTAAAGGTCTTCAGGAGGGCAGG - Intergenic
1060346553 9:122821991-122822013 GTGGAGGGCTGCAAGATGGGAGG - Intronic
1061059669 9:128244189-128244211 GTGTATGTCTTTGGGATGTGAGG + Intronic
1195706141 X:107739189-107739211 ATGTAGGTCTTCACGAATGGAGG - Intronic
1196123385 X:112074436-112074458 GTGTAGGAATTCCGGATTGGTGG - Intronic
1196590348 X:117480384-117480406 GTCTAGGTCTTCAGCAAGGCTGG + Intergenic
1198935964 X:141903228-141903250 TTGCAGGTCTCAAGGATGGGAGG + Intergenic
1198962412 X:142196124-142196146 TTGCAGGTCTTAGGGATGGGAGG - Intergenic