ID: 1012175929

View in Genome Browser
Species Human (GRCh38)
Location 6:96084617-96084639
Sequence GTCTCATAGAAATTAGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012175929 Original CRISPR GTCTCATAGAAATTAGACTA AGG Intronic
900541084 1:3203184-3203206 TTCTCAAAGAAGTTAGGCTATGG + Intronic
910515639 1:88056816-88056838 TTCTCAAAGAAAGTAGACAATGG - Intergenic
910660486 1:89666670-89666692 GACTAACAGAAATTAGAGTAAGG - Intronic
911805143 1:102197258-102197280 GTTTCTTATAAATTAAACTATGG + Intergenic
912019297 1:105086609-105086631 CTCTCTTAGAAATTAGATTTAGG - Intergenic
912137278 1:106676881-106676903 GTCTAATGGAAATTAGACAAGGG - Intergenic
916404685 1:164486369-164486391 GCCTCATGGATATTAGACTGTGG + Intergenic
918835577 1:189460537-189460559 GTCTCATAGAATTTATATTCTGG - Intergenic
921091411 1:211847384-211847406 GTCTCAAAAAAAATAGACTAGGG - Intergenic
921988105 1:221334609-221334631 GGCTGAAAGAATTTAGACTAGGG - Intergenic
922985729 1:229864826-229864848 GTTTCATGGAAATTAGATTTCGG + Intergenic
924363080 1:243261355-243261377 GTCTTATGGAAATGAGAGTAAGG + Intronic
1063370878 10:5522265-5522287 CTCTCAGAGATATGAGACTATGG - Intergenic
1066627591 10:37424320-37424342 GCCTCATATAAATTAGGATATGG + Intergenic
1068139626 10:52989361-52989383 GTCTCTTAGGAAATAGACTGAGG + Intergenic
1068213748 10:53955387-53955409 GTCTAATAGAAATAAGTCAACGG + Intronic
1073651940 10:105370346-105370368 GTCTCAGGGATATTAGTCTAAGG - Intergenic
1073678766 10:105679426-105679448 GTCCCACAGATAATAGACTAGGG + Intergenic
1077910692 11:6569478-6569500 GTCTCAAAAAAAAAAGACTAGGG + Intronic
1081041306 11:38217543-38217565 GTGTAATAAAAATGAGACTATGG - Intergenic
1082774481 11:57235042-57235064 TTCTCATAGAAAATAGAGGAAGG + Exonic
1083223656 11:61269878-61269900 GTCTCATTGAAATTAGAGTTGGG - Intronic
1085583378 11:77676410-77676432 GACTCATAGAAGTTGGACTTGGG - Intronic
1086267260 11:85015871-85015893 ATCTCATAGAAATTACAGAATGG + Intronic
1089121076 11:116135692-116135714 GGCTCAAAGAAATTAGCCTGAGG - Intergenic
1089193913 11:116679991-116680013 GTCTCAAGGAAAAGAGACTAAGG - Intergenic
1091435465 12:469381-469403 GTCTGATAGGAATTAGAGAATGG + Intronic
1095042615 12:37459462-37459484 GTCACATGGAAAAAAGACTAAGG - Intergenic
1097673990 12:62577294-62577316 TTCTCATAGAACTTAGATTCTGG - Intronic
1099363937 12:81744272-81744294 GTATCATAAATATTAGACTGGGG + Intronic
1100326479 12:93544395-93544417 GTCCCATAGAAATGATATTACGG - Intergenic
1101362426 12:104040748-104040770 GTCTCATAGTACTTAGAAAATGG - Intronic
1106573896 13:30956589-30956611 GTCTCCTACAGATAAGACTAAGG - Intronic
1112387184 13:98950662-98950684 ATTTCATAAAAATTAGACTTTGG - Intronic
1115266262 14:31503823-31503845 GTCTCATAAAAATGAGATTCTGG - Intronic
1118846132 14:69549069-69549091 GTCTCATATAAATAATAATAAGG + Intergenic
1121016838 14:90554084-90554106 GTTTCAAAGAAATTAGGCCAAGG - Intronic
1122017862 14:98811667-98811689 GTATGATAGAAATTAGAAAAGGG + Intergenic
1131717082 15:95123558-95123580 CTCTCATAAAAATTATTCTAGGG + Intergenic
1134198495 16:12178003-12178025 GTCTAAGACAAAGTAGACTACGG - Intronic
1136521883 16:30802079-30802101 GTCTCATAGAAGGTACACAAGGG - Intergenic
1138046233 16:53728486-53728508 GTATCCTAGAACTTAGACCAGGG - Intronic
1150320001 17:64205484-64205506 GTCTCTTATAACTTAGAGTAAGG - Intronic
1150820973 17:68434069-68434091 TTCTCACATAAATAAGACTATGG - Intronic
1150934539 17:69621017-69621039 CTCACATAGGAATTAGAATATGG + Intergenic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
925581696 2:5417568-5417590 GTCTCATCTAAATTAGACATGGG + Intergenic
926294337 2:11557772-11557794 GTCTGAGAGAAACTAGACTGTGG + Intronic
926389390 2:12372379-12372401 GTTTCCTAGAAAGAAGACTAAGG - Intergenic
932556880 2:72832391-72832413 GTCTCATAGAAATTAGAAAGAGG - Intergenic
933156152 2:78978007-78978029 GAATTATAGAAACTAGACTATGG + Intergenic
933827369 2:86174942-86174964 ATCCCATAGATATTACACTACGG - Intronic
935700377 2:105806971-105806993 GTCTTACAGCAATTAGACAAAGG - Intronic
936645467 2:114364642-114364664 GGATCATGGAAAATAGACTAGGG + Intergenic
939340340 2:140887052-140887074 GTCTCACAGTAATTAGTTTAGGG - Intronic
940176481 2:150882877-150882899 GTCTCATAGGAATCATACTTGGG + Intergenic
941314721 2:163978402-163978424 CTCTCATAGAAATCAGCCTTGGG + Intergenic
945718149 2:213384103-213384125 TTATTATAGAAACTAGACTAGGG + Intronic
947083055 2:226420204-226420226 GTCTCATTGAACTTAAGCTACGG - Intergenic
948068488 2:235100802-235100824 GTCTCATACAAATGAGAGAAAGG - Intergenic
1174715742 20:52756436-52756458 GTCTCATGGAATTTAGAATCAGG + Intergenic
1182943686 22:34302150-34302172 CTCTCAAAGAACTTAGACCAGGG - Intergenic
953420168 3:42748174-42748196 GACTCATAGATATTTGACAAAGG + Intronic
956293421 3:67686137-67686159 GTCACGTAGATATTAGACCAGGG + Intergenic
957381046 3:79430043-79430065 GTATCATAAATGTTAGACTATGG - Intronic
957798230 3:85039952-85039974 GTCTTATGGAAATCAGCCTAAGG - Intronic
960040033 3:113141289-113141311 GTTTTGTAGAAATTAAACTAAGG + Intergenic
964096359 3:152935783-152935805 CTCTCATAGAAAGTATATTAGGG - Intergenic
964568817 3:158090045-158090067 GTCTCAGAGAGATGTGACTAAGG - Intergenic
970036725 4:11744241-11744263 GGCTCAAAGAAATATGACTAAGG - Intergenic
971114681 4:23631060-23631082 GTCCCATAGGAATAAGAGTAGGG - Intergenic
971383250 4:26119230-26119252 GTGTCAGAGAAATGAGACAATGG - Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
974148609 4:57976768-57976790 GTCTGATAGAAAGTAGAGGAGGG - Intergenic
976892300 4:90064645-90064667 GCTTCATAGAATTTAGAGTATGG + Intergenic
980227315 4:130003242-130003264 GTTTCATACAAATTTGACTCTGG - Intergenic
980249268 4:130293055-130293077 GACTCAGAGAAATGAGAGTATGG + Intergenic
980753687 4:137127444-137127466 TTCTAAAAGAAAGTAGACTAAGG + Intergenic
982741787 4:159064783-159064805 GTCTCAATGGAATTAGACTAAGG - Intergenic
984399601 4:179244424-179244446 TTCTCATAGAAATAACACTGTGG - Intergenic
986290863 5:6397706-6397728 GTGTCCTAGGAATTAGACTCGGG - Intergenic
989451481 5:41591434-41591456 GTCTAATATAAATGTGACTATGG - Intergenic
992706443 5:79399307-79399329 TTCTCAGAGAAATAAGACTATGG - Intronic
993624092 5:90203330-90203352 GTTTCATAGAAAGCAGACTGGGG - Intergenic
993713022 5:91246818-91246840 GCCTCATATAAATTTGACTGGGG + Intergenic
994331323 5:98509744-98509766 GTCCCTTAGTATTTAGACTAAGG - Intergenic
996220047 5:120920086-120920108 GGCTCATATAAATTATCCTAAGG - Intergenic
996254087 5:121376790-121376812 GTCCCAGAGAAATCAGATTAAGG + Intergenic
997003490 5:129790332-129790354 GTCTCATAGACCTGAGACTGTGG + Intergenic
997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG + Intergenic
1000543340 5:162568092-162568114 GTCCCATAGAAATAAGTATATGG - Intergenic
1001063593 5:168516698-168516720 GTCTCATAGGCATAAGACTGGGG - Intronic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1005464737 6:26101459-26101481 GTCTCACCCAACTTAGACTATGG - Intergenic
1009698362 6:67141071-67141093 GTCTCATGCAAATTAGACTAAGG + Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1012697789 6:102410606-102410628 CTGTCATAGATATTATACTATGG - Intergenic
1018270771 6:162074949-162074971 GTTTCATAGAATTTAAACAATGG + Intronic
1020383512 7:7570924-7570946 GACTCATATAATTTAGACCAGGG - Intronic
1022794428 7:33720858-33720880 GTCTAAAAGAAATTAGGCTCTGG + Intergenic
1033022314 7:137738789-137738811 GTATCAAAGAAAATAGACAATGG - Intronic
1039598623 8:38813904-38813926 GTTTCATAGAAATTAAGCTGGGG + Intronic
1047885050 8:129240922-129240944 GTCTCATAGAGCTTATACTTGGG - Intergenic
1048641535 8:136368867-136368889 GTCTCATATAAACTACACTTGGG - Intergenic
1051028107 9:12638556-12638578 GTCTCATAGGAATTATCCTTTGG - Intergenic
1051103151 9:13546049-13546071 GACACCTAAAAATTAGACTATGG - Intergenic
1058932912 9:109739688-109739710 GTCTCATAGAAATTAAAAAGAGG - Intronic
1060617443 9:125031163-125031185 GTCTCAAAGAATTTAGGGTATGG + Intronic
1188766190 X:34094923-34094945 GACTCAGAGCAATTAGACAAGGG + Intergenic
1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG + Intergenic
1191270841 X:58466729-58466751 GTCACATAAAAACTAGACAAAGG + Intergenic
1193184352 X:78494832-78494854 GCCTCATAGAAATTTGACCAAGG + Intergenic
1193913113 X:87329003-87329025 GACTCACAGAATTTAGAATATGG + Intergenic
1195411850 X:104575999-104576021 GTGACACAGAATTTAGACTAAGG + Intronic
1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG + Intergenic
1199748275 X:150790175-150790197 CGCTAATAGAAACTAGACTAGGG + Intronic