ID: 1012181321

View in Genome Browser
Species Human (GRCh38)
Location 6:96156512-96156534
Sequence ATATATAAGCTGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 2, 2: 8, 3: 25, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012181314_1012181321 24 Left 1012181314 6:96156465-96156487 CCTGAAAGCAGGTTGCCAGTTTT 0: 1
1: 0
2: 8
3: 51
4: 237
Right 1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG 0: 1
1: 2
2: 8
3: 25
4: 152
1012181318_1012181321 1 Left 1012181318 6:96156488-96156510 CCTTCGCAGTACAAGGGCTTATA 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG 0: 1
1: 2
2: 8
3: 25
4: 152
1012181315_1012181321 9 Left 1012181315 6:96156480-96156502 CCAGTTTTCCTTCGCAGTACAAG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG 0: 1
1: 2
2: 8
3: 25
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012181321 Original CRISPR ATATATAAGCTGATGGAGCT GGG Intronic
903973495 1:27134295-27134317 ACAGATAAGATGATGGGGCTGGG + Intronic
904549322 1:31302286-31302308 ATATAGAAGAAGAAGGAGCTAGG - Intronic
904696972 1:32336257-32336279 ATATATAAGCGCCCGGAGCTCGG + Exonic
909198244 1:72654609-72654631 ATTTAAAAGCTGATCTAGCTAGG + Intergenic
910346668 1:86246798-86246820 ATATACCAGCTGATGAAACTGGG + Intergenic
916673496 1:167046142-167046164 ATATATAAGCAGATGAGGCCAGG + Intergenic
918014120 1:180616462-180616484 TTAGAAAAGCTGATAGAGCTTGG + Intergenic
1062838994 10:655155-655177 ACATAGAAGCTGATGGGGCTGGG - Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1066307676 10:34162266-34162288 ATATCCAAGCTGATGGCGCTGGG - Intronic
1068150837 10:53128615-53128637 TTTTATAAGCTGTTGGTGCTTGG - Intergenic
1068351280 10:55848673-55848695 ATATATAAGCTGATGGGGCTAGG - Intergenic
1072363339 10:94682786-94682808 ATAGAAAAGCTGATGAGGCTGGG + Intergenic
1073314340 10:102567871-102567893 AAACATAGGCTGCTGGAGCTAGG - Intronic
1073558152 10:104473390-104473412 ATATATAAGCTGATGGGTCTGGG + Intergenic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1086513646 11:87587992-87588014 ATATATGAGCTGCTAGAACTGGG + Intergenic
1090873382 11:130767506-130767528 ACACACAAGCTGATAGAGCTGGG - Intergenic
1091086779 11:132728412-132728434 AGACAAAAGATGATGGAGCTAGG + Intronic
1091237213 11:134030416-134030438 ATATAGAAGCCGAAAGAGCTCGG - Intergenic
1092931133 12:13316924-13316946 ATAGAAAAGCTGATGGGGCTGGG - Intergenic
1093392496 12:18639315-18639337 AAATTAAAGCTAATGGAGCTGGG + Intronic
1093778281 12:23103173-23103195 ATCCATGAGCTGAAGGAGCTGGG - Intergenic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1099638695 12:85253886-85253908 ATATATCTGCTGATGTAGTTTGG + Intronic
1104667440 12:130657501-130657523 ATAACTAAACTGATAGAGCTTGG + Intronic
1106787561 13:33122325-33122347 ATAACGAAGCTGAGGGAGCTGGG - Intronic
1108160242 13:47631751-47631773 CTATATAAGCTAATAGGGCTGGG + Intergenic
1108556831 13:51601700-51601722 ATGTAGAAACTGATGCAGCTAGG + Intronic
1108966018 13:56302911-56302933 ATATGTAAGCTATTGGAGTTGGG + Intergenic
1109831179 13:67791100-67791122 TTTTATAAGCTGATGAGGCTGGG + Intergenic
1112909299 13:104462130-104462152 ATATGAAAGTTGATGGAGGTCGG - Intergenic
1113035461 13:106042882-106042904 ACATCTGAGCTGATGGAGATTGG - Intergenic
1113219656 13:108085281-108085303 ATATATAAGCTGATGGGGCTGGG - Intergenic
1115298740 14:31859920-31859942 ATCTAGCAGGTGATGGAGCTTGG + Exonic
1116643739 14:47499600-47499622 GTATATAAGCTGATAGTGGTAGG - Intronic
1116741704 14:48763312-48763334 ATATACAAGCTGATAGAGTCGGG + Intergenic
1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG + Intergenic
1117385916 14:55212711-55212733 CTATATCCGCTGATGGGGCTGGG + Intergenic
1118879692 14:69815750-69815772 ATAGATAACCTCAAGGAGCTTGG - Intergenic
1123909577 15:24954109-24954131 ATTTAGACGCTGATGTAGCTTGG - Intronic
1126356014 15:47796674-47796696 AAATATAAGCTAATGGATTTAGG + Intergenic
1127214594 15:56811010-56811032 ATATATCTGCTGATGGGGCTGGG - Intronic
1127604715 15:60574794-60574816 ACGTATTAGCTGATGGATCTTGG - Intronic
1129925873 15:79364178-79364200 ATATAGAAGCTGATGGGACTGGG + Intronic
1133717523 16:8464060-8464082 TTATATAGGCTGAAGGAGATGGG + Intergenic
1135952085 16:26924051-26924073 ATTAAAAAGCTGCTGGAGCTGGG + Intergenic
1137299739 16:47137344-47137366 ATGCAGAAGCTGCTGGAGCTGGG + Intronic
1138305289 16:55968996-55969018 AAATACAAGTTCATGGAGCTCGG - Intergenic
1139872406 16:70118163-70118185 AGATAGCAGTTGATGGAGCTAGG + Intronic
1140578312 16:76199005-76199027 GTATAAAAGCTGATAGGGCTGGG + Intergenic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1155355215 18:24945292-24945314 AAATAAAAGCAGTTGGAGCTTGG - Intergenic
1155990890 18:32278231-32278253 ACATACAAGATGATGGATCTAGG + Intronic
1156388876 18:36631686-36631708 ATATATTAGCTGTGGGACCTTGG - Intronic
1157693410 18:49701581-49701603 ATCTATAAAATGATGGGGCTGGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158335039 18:56406864-56406886 ACATACCAGCTGATGGGGCTGGG + Intergenic
1159374427 18:67574711-67574733 ATATATAGGCTGATGCAAATTGG - Intergenic
1159981033 18:74779402-74779424 ATATATAAGCTGACCGGGCGCGG - Intronic
1160818919 19:1049140-1049162 CTATAAAAGCTGCGGGAGCTTGG - Intronic
1166970925 19:46567060-46567082 ACATATATGCTGCTGGAGTTTGG - Intronic
1167758483 19:51427958-51427980 TTATATAAGCTGATGGGGCTGGG - Intergenic
1168334128 19:55587221-55587243 ATAGATACGCTGATTGAGGTTGG - Intergenic
926926704 2:17994999-17995021 ATATAAAGGTTGATGGGGCTGGG - Intronic
926927493 2:18002152-18002174 ATATAAAAGCTGATGGGGCTGGG - Intronic
933374065 2:81456424-81456446 TTATATCAGTTGATGGAGTTAGG - Intergenic
933534179 2:83551864-83551886 ATGTAAAAGCTGATGGGGCTGGG - Intergenic
934115376 2:88785930-88785952 ATATCCAAGCTGATGAAGCTGGG + Intergenic
934631274 2:95926064-95926086 ATATCCAAGCTGTTGAAGCTGGG - Intronic
934833435 2:97557650-97557672 ATATCCAAGCTGTTGAAGCTGGG - Intronic
941199348 2:162490288-162490310 ATATCTAAGCTGATGGGGCTGGG - Intronic
941200017 2:162496455-162496477 ATATCTAAGCTGATGGGGCTGGG - Intronic
941438673 2:165506223-165506245 AGATCTAAACTGTTGGAGCTAGG - Intronic
945257107 2:207811982-207812004 ACAAATAAGCTAATGGAGCTGGG - Intergenic
946013310 2:216583924-216583946 ATATAAAAAATGATGCAGCTGGG + Intergenic
1169961876 20:11169106-11169128 ATACTTAAGCTGATAGAGGTAGG + Intergenic
1170244477 20:14205455-14205477 TTATAAAAGCTGATGGGGCTGGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1177240907 21:18455473-18455495 ATATTTAGGCTGATGAAGTTAGG + Intronic
1179053261 21:37907514-37907536 ATAAAGAAGCTGAGAGAGCTAGG - Intronic
951194774 3:19812005-19812027 ATATAAAAACTGATGGGGCTGGG - Intergenic
951223919 3:20098548-20098570 ATCTATAAGATGATGAAGCTGGG - Intronic
952635566 3:35525301-35525323 ACATATAGGATGATGCAGCTGGG - Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
970344038 4:15136018-15136040 ATATGGAAGCTGCTGAAGCTTGG + Intergenic
970784890 4:19783846-19783868 ATGTATAAGCTGCTAAAGCTTGG + Intergenic
971493333 4:27237524-27237546 ATATATATGGTGAAGGAGCTAGG - Intergenic
971739524 4:30502466-30502488 AAATAAAAGCTTATGGAGATTGG + Intergenic
971986019 4:33825359-33825381 ATATATATGCTCATGTAGTTGGG - Intergenic
972176712 4:36417238-36417260 ATATATCCGCTGATGGGGCTGGG + Intergenic
973001531 4:44957611-44957633 ATATCCAAGCTGATGGGGCTGGG - Intergenic
974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG + Intergenic
974724335 4:65778876-65778898 ATAAAGAAGGTGATGCAGCTGGG + Intergenic
975658552 4:76665759-76665781 AGATTCAAGTTGATGGAGCTAGG + Intronic
977872537 4:102109422-102109444 ATATATAATCTGCTGCAGTTGGG - Intergenic
978247816 4:106596220-106596242 ATTTATTGGCTGATGGAACTGGG + Intergenic
979588821 4:122453455-122453477 ATATGAAAGGTGATGGAGTTTGG + Intronic
980622596 4:135328552-135328574 CCATATAAACTAATGGAGCTTGG - Intergenic
980721135 4:136697066-136697088 ATAAATAATCTGATGAGGCTGGG + Intergenic
981520584 4:145657833-145657855 ATATAAATGCTGATGAAGTTTGG + Exonic
983686860 4:170420676-170420698 ATGTACAAGCTGAAGGGGCTGGG - Intergenic
986650107 5:9954748-9954770 AGATATAAGCTGTAGAAGCTTGG - Intergenic
989584509 5:43064146-43064168 ATTTAAAAGCTGATGGGGCTAGG - Intergenic
992047806 5:72913803-72913825 ATATATAAGCAAATTGAGCTTGG + Exonic
992243907 5:74797926-74797948 ATATATAAGCTTAATGAGCATGG + Intronic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
994184481 5:96803173-96803195 ATATTTACTCTGATAGAGCTGGG + Intronic
995189142 5:109302300-109302322 ACATCTTAGCTGATGGAACTAGG + Intergenic
997043760 5:130289099-130289121 ATATGTAAGGTAATGGAGTTGGG - Intergenic
1002127791 5:177059694-177059716 ATATAAAAGCTGAAGAAACTGGG - Intronic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005399027 6:25412638-25412660 ATATATTAAATAATGGAGCTTGG + Intronic
1009169847 6:60384674-60384696 ATTTAAAAGCTGATGAGGCTGGG + Intergenic
1010828321 6:80499320-80499342 ATTTAAAAGCTGTTGTAGCTGGG - Intergenic
1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG + Intronic
1014987545 6:128030120-128030142 AGATATGAGCTGATAGTGCTGGG + Intronic
1015006915 6:128294052-128294074 ATATGTAATATGATGGAGATGGG - Intronic
1017976807 6:159365445-159365467 ATTTATATGTTGATGGAGGTGGG + Intergenic
1018071995 6:160173098-160173120 ATAAATAAGCAGATGTAGCGAGG + Intronic
1019970958 7:4540334-4540356 ATCTATAAACTGATGGGGTTTGG + Intergenic
1020596626 7:10214329-10214351 ACATACAAGCTGATGAAGGTGGG + Intergenic
1020848691 7:13321062-13321084 ATATATATTCTTATGGGGCTAGG + Intergenic
1021315126 7:19139244-19139266 ATTTGTTAGCTGATTGAGCTTGG + Intergenic
1021414663 7:20368584-20368606 ATATATAAGCTGCTGAAAATTGG - Intronic
1024007344 7:45235722-45235744 ATATATAAGTAGGTGGAGATAGG + Intergenic
1024486534 7:49926313-49926335 ATAGAGAAGCTGATGGAATTGGG - Intronic
1024752309 7:52481914-52481936 ATATATCACCTGATGGGGCATGG - Intergenic
1026205231 7:68251594-68251616 ATTAATAAGCTCATGGGGCTGGG - Intergenic
1026449131 7:70511969-70511991 ATTTATAAGCTCATGAAGTTGGG - Intronic
1028493168 7:91436676-91436698 GTATATGAGATGATGGAGTTAGG - Intergenic
1028692516 7:93669538-93669560 CTTTATAACCTTATGGAGCTGGG - Intronic
1031518668 7:122735327-122735349 ATATGTAAGTTGAAGGAGCTGGG - Intronic
1032826724 7:135577000-135577022 ACAGATGAGCTGATGGAGCAAGG + Exonic
1033532323 7:142277224-142277246 GTTTATCAGCTGAAGGAGCTTGG - Intergenic
1033621203 7:143063316-143063338 ATATATGTGCTGATGCTGCTGGG - Intergenic
1033732013 7:144189306-144189328 AAATAGAAACTGATGGAACTGGG + Intronic
1033742862 7:144287889-144287911 AAATAGAAACTGATGGAACTGGG + Intergenic
1033751040 7:144361725-144361747 AAATAGAAACTGATGGAACTGGG - Intronic
1034841183 7:154398989-154399011 TTATGTAAGCTGTTGGAGCAGGG + Intronic
1035388004 7:158487545-158487567 ATATATAATCTTATCAAGCTTGG - Intronic
1036443347 8:8800764-8800786 AGATAAAAGCAGGTGGAGCTGGG - Intronic
1036908537 8:12731136-12731158 ACACAGCAGCTGATGGAGCTGGG - Intronic
1038085751 8:24194543-24194565 ATAGAAAAGCTGATGGATCCAGG + Intergenic
1038705301 8:29887918-29887940 GTTTACAAGCTGATGGAGCAGGG - Intergenic
1040614044 8:49017371-49017393 ATAAATAACCTGATGGATCTGGG - Intergenic
1040644131 8:49378771-49378793 AAATATAAGCTGATGAGGCTGGG + Intergenic
1041194047 8:55382698-55382720 GAATATAAGCTGATAAAGCTTGG - Intronic
1042427151 8:68661607-68661629 ATATATAAGCTGATGGGACTAGG + Intronic
1042721436 8:71830867-71830889 GTACATAATCTGATGGTGCTAGG - Intronic
1043049456 8:75366716-75366738 AGACATAAGATGATGGAGGTAGG + Intergenic
1043206319 8:77447338-77447360 ATATCTATACTGATGGGGCTTGG - Intergenic
1043586892 8:81780475-81780497 ATGAATATCCTGATGGAGCTAGG + Intergenic
1043690867 8:83149966-83149988 ATATAAAAGCTGATGAGGTTGGG - Intergenic
1044030813 8:87234331-87234353 ATAATTATTCTGATGGAGCTGGG - Intronic
1045274763 8:100693296-100693318 ACAAATAAGATGATGGGGCTAGG + Intronic
1047710731 8:127549836-127549858 AGATATAAGATGTTGGAGCTGGG - Intergenic
1051034407 9:12725587-12725609 ATATATAAAATGATGGAGGCCGG - Intergenic
1051366780 9:16326988-16327010 ATTTAGAAGGTGATGGATCTGGG + Intergenic
1051680480 9:19602707-19602729 AGGTAGAAACTGATGGAGCTGGG - Intronic
1052304676 9:26993758-26993780 AAATATGAGCTGATGGAGCTGGG - Exonic
1053605167 9:39650869-39650891 ATATATAGGCTGACAGACCTAGG + Intergenic
1053863085 9:42407496-42407518 ATATATAGGCTGACAGACCTAGG + Intergenic
1054248374 9:62691546-62691568 ATATATAGGCTGACAGACCTAGG - Intergenic
1054562488 9:66726072-66726094 ATATATAGGCTGACAGACCTAGG - Intergenic
1054919306 9:70526057-70526079 ATGTATAAAATGATGGGGCTGGG + Intergenic
1056505727 9:87256558-87256580 AGATATTAACTGATGGAGCCAGG - Intergenic
1058132024 9:101264322-101264344 ATATCTATATTGATGGAGCTGGG + Intronic
1058154796 9:101503112-101503134 AGATATAAGCTGAAGTAGTTGGG + Intronic
1058486863 9:105450422-105450444 ATTTATAAGCTGTATGAGCTGGG + Intronic
1058809508 9:108625967-108625989 AGATAAAATCTGATGGAGCTAGG + Intergenic
1059614750 9:115937189-115937211 ATATAGAAGCTGATGCAGGTGGG + Intergenic
1062505741 9:136875000-136875022 ATAAAGAAACTGATGGGGCTGGG + Intronic
1192104562 X:68301771-68301793 ATAAATAAGGTGATGGAGAGAGG - Intronic
1192347576 X:70323771-70323793 ATATGTAAGCTGAAGTAGTTAGG - Intronic
1193698231 X:84735385-84735407 ATATAAAAGCTGATGGGGCTGGG - Intergenic
1194996686 X:100598856-100598878 AAATATCAGCTGAAGGAGCTTGG + Intronic
1195083472 X:101391949-101391971 ATCTAGTAGGTGATGGAGCTGGG + Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1196694773 X:118600110-118600132 TTAAATGAGATGATGGAGCTGGG + Intronic
1197435328 X:126420896-126420918 ACATACAAGCTGATCGGGCTGGG - Intergenic
1197509810 X:127356566-127356588 ATAGCCAAGCTGATGGGGCTGGG - Intergenic
1198154633 X:133946697-133946719 AGATGTTAGCTGATGGAGCCTGG + Intronic
1198417723 X:136437152-136437174 ATATGCAGGCTGATGGAGTTGGG - Intergenic
1199433188 X:147783753-147783775 ATTTATCAGCTGATGGACTTTGG - Intergenic
1200838929 Y:7760659-7760681 ATACATAAGCTAATGAAACTAGG - Intergenic