ID: 1012183596

View in Genome Browser
Species Human (GRCh38)
Location 6:96186435-96186457
Sequence CATACTAAGAAGAAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012183596_1012183598 2 Left 1012183596 6:96186435-96186457 CCTGCAGCCTTCTTCTTAGTATG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1012183598 6:96186460-96186482 AACGTCCCTGATATGCACGATGG 0: 1
1: 0
2: 0
3: 0
4: 32
1012183596_1012183601 28 Left 1012183596 6:96186435-96186457 CCTGCAGCCTTCTTCTTAGTATG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1012183601 6:96186486-96186508 TTGTTTTGTAACTGTGTATTAGG 0: 1
1: 0
2: 4
3: 55
4: 648
1012183596_1012183602 29 Left 1012183596 6:96186435-96186457 CCTGCAGCCTTCTTCTTAGTATG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1012183602 6:96186487-96186509 TGTTTTGTAACTGTGTATTAGGG 0: 1
1: 0
2: 2
3: 35
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012183596 Original CRISPR CATACTAAGAAGAAGGCTGC AGG (reversed) Intronic
900835175 1:4997761-4997783 CATAGGAAGAAGAGGGTTGCAGG - Intergenic
902077602 1:13800387-13800409 CTTACAAAGAAGAAGACAGCTGG + Intronic
903874606 1:26464876-26464898 CTTACTGAGAGGAAGGCAGCGGG + Intronic
904326715 1:29731297-29731319 CACACTGAGAAGAGGGCAGCAGG - Intergenic
905770698 1:40636274-40636296 CAGACTAGAAAGATGGCTGCAGG + Intronic
906020516 1:42624835-42624857 CATACAAAAAAGAAAACTGCAGG - Intronic
906091411 1:43182625-43182647 AATAGTAATCAGAAGGCTGCTGG + Intronic
908106664 1:60851139-60851161 CATACTAAGAAGAAAGTTTGTGG + Intergenic
908514337 1:64876512-64876534 CTTATTAAGGAGAAAGCTGCCGG - Intronic
910139579 1:84012404-84012426 CCTACTAATCAGAAGTCTGCTGG + Intergenic
912747435 1:112256918-112256940 TATACTTAGAAAAAGGATGCAGG - Intergenic
917237416 1:172909364-172909386 CATACTAAAAAAAAGGTTGGTGG + Intergenic
921412501 1:214850652-214850674 AGTCATAAGAAGAAGGCTGCTGG + Intergenic
921482024 1:215674659-215674681 TATACTGAGAGTAAGGCTGCAGG + Exonic
922261415 1:223948703-223948725 CATACTGAGTAGAAGGCTTTGGG - Intergenic
922735659 1:227977040-227977062 CATACTGAGTAGAAGGCTTTGGG + Intergenic
1063515355 10:6689770-6689792 CATACACAGAGGAAGGCTGTGGG - Intergenic
1063928907 10:11009509-11009531 CACACTCAGAAGAAAGCTGTGGG - Intronic
1065092036 10:22244910-22244932 CATACTAATGAGCATGCTGCTGG - Intergenic
1066733896 10:38454672-38454694 CATACTGAGTAGAAGGCTTTGGG + Intergenic
1069854937 10:71434908-71434930 CATGCCAAGAAGAAGGCAGATGG - Intronic
1070354969 10:75631104-75631126 CTTCCTAAGAAGAAGTCAGCAGG - Intronic
1070557008 10:77536331-77536353 GATTCTAACAAGAAGGATGCTGG - Intronic
1070599782 10:77857484-77857506 CAGGCTAAGAGGAGGGCTGCTGG + Intronic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071502217 10:86212118-86212140 CATTCTCAGAACAAGGCTGTGGG + Intronic
1073592942 10:104773577-104773599 CATACAGAGCAGAAGGCAGCAGG + Intronic
1074210985 10:111334966-111334988 GAGACTTAGAAGACGGCTGCTGG + Intergenic
1075305002 10:121359962-121359984 CAAACTAACAAGAAGCCTGCAGG + Intergenic
1075591837 10:123697582-123697604 CCTACTACTCAGAAGGCTGCGGG - Intergenic
1075789790 10:125075911-125075933 CATACCTAGAAGAAGATTGCTGG - Intronic
1076379694 10:130016549-130016571 AATAGTAAGAAGAAGGCAGAAGG + Intergenic
1081803187 11:45873766-45873788 CAAGCTTAGCAGAAGGCTGCTGG + Intronic
1087079181 11:94153218-94153240 CATACAAAGAAAAAGGAAGCAGG - Intronic
1088577686 11:111287538-111287560 GAAGCTAAGAAGAAGGGTGCAGG - Intergenic
1089360391 11:117882157-117882179 CATTCTATGAAGAGGGATGCCGG - Intergenic
1093673735 12:21908746-21908768 CTTACTGACAAGAAGGCTGACGG + Intronic
1094042284 12:26130817-26130839 CATGGTCAGAAGATGGCTGCAGG + Intronic
1095208574 12:39466979-39467001 CAGGCTAAGAAGAAAGCTGCTGG - Intergenic
1096943754 12:55380778-55380800 CATCTTGAGAAGAAGCCTGCTGG - Intergenic
1102362728 12:112302300-112302322 CAGGCTGAGAAGAAAGCTGCTGG - Intronic
1103245663 12:119454920-119454942 CATGCTCAGAAAATGGCTGCTGG + Intronic
1104111022 12:125704351-125704373 CATACTTAGAAGCAGTCTTCTGG + Intergenic
1105289631 13:19043375-19043397 ATTAATAAGGAGAAGGCTGCTGG + Intergenic
1106806241 13:33310360-33310382 CTTATAAAGAAGAAGGCTGGAGG - Intronic
1114463381 14:22902696-22902718 CAAGCTAAGAACAAGGCTCCTGG + Intronic
1114735912 14:25043876-25043898 GCTATTAAGAATAAGGCTGCTGG + Intronic
1114910421 14:27188098-27188120 CATACTGAGAAGAATTATGCTGG - Intergenic
1115630036 14:35235604-35235626 CAGGCCAAGAAGAAAGCTGCTGG - Intronic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1116343362 14:43755020-43755042 CATTCTCATAAGGAGGCTGCTGG - Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1120451767 14:84677423-84677445 CATAATAAGCAGAATGATGCTGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127863919 15:63016301-63016323 CCTTCTAAGAAGAAGTTTGCTGG - Intergenic
1134866083 16:17608405-17608427 CTTACTAACAAGAAGACTGGAGG + Intergenic
1135647799 16:24178488-24178510 CATGCTCAGAAGCAGGCAGCTGG - Intronic
1137930548 16:52583398-52583420 AATACAAGGAAGAAGGCTGGTGG - Intergenic
1141908790 16:87044672-87044694 CTTAGAAAGAAAAAGGCTGCTGG - Intergenic
1144007733 17:11116267-11116289 AATAATAAGAAGAAGACTGAGGG + Intergenic
1149555509 17:57570801-57570823 CATGGTATGCAGAAGGCTGCTGG + Intronic
1150524978 17:65913040-65913062 CATACTAAGAAACAGGCAACAGG + Intronic
1151101206 17:71557361-71557383 CCCACTAAGAAGAAGGCATCAGG - Intergenic
1156391056 18:36651116-36651138 CACACTAAGCAGAAGTCAGCAGG - Intronic
1156465540 18:37346117-37346139 CAGACATAGAAGGAGGCTGCAGG - Intronic
1157008055 18:43610252-43610274 TAAACTAGGATGAAGGCTGCTGG - Intergenic
1158892637 18:61887416-61887438 AATAGTAAGAAGAATGCTCCTGG + Intronic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1161249764 19:3274179-3274201 CAAACTCAGGAGAAGGCAGCTGG - Intronic
1162210923 19:9091400-9091422 CATGCTAAGAATAAAGCTGTTGG + Intergenic
1164708973 19:30340681-30340703 CATACTAAGAAAAAGCATTCAGG - Intronic
1166654429 19:44599804-44599826 CCTAGTGAGAAGAAGTCTGCTGG + Intergenic
929300030 2:40292743-40292765 CATCCTGAGGAAAAGGCTGCTGG + Intronic
930257443 2:49108538-49108560 CAAACTAGGCAGAAGGCTGAGGG + Intronic
931465851 2:62486231-62486253 CATTCTAATGATAAGGCTGCTGG + Intergenic
932420992 2:71601255-71601277 CATACTAAGAGGAAGTTTGAAGG - Intronic
933628784 2:84633069-84633091 CATTCTATGAAGAAGCCTGCTGG - Intronic
940859349 2:158756098-158756120 CATGATAAGAGGTAGGCTGCAGG + Intergenic
943347109 2:186752050-186752072 CAGACTGACAAGAAGGCTGTAGG + Intronic
944315860 2:198285233-198285255 CATTCTAGGAAGAAGTCTGCAGG - Intronic
948447221 2:238042375-238042397 CAAACTCAGAAGAAGGCCACAGG - Exonic
1169585836 20:7084300-7084322 CATACTAAAAAGAAGTATACAGG + Intergenic
1175342373 20:58241837-58241859 CCTGCTAGAAAGAAGGCTGCTGG - Intergenic
1178195536 21:30340630-30340652 GAAATTAATAAGAAGGCTGCTGG - Intergenic
1179569376 21:42269073-42269095 CATAGTCAGATGATGGCTGCTGG + Intronic
1179821018 21:43936940-43936962 CATATTTAGAAGTAGGCTGTGGG + Intronic
1180858612 22:19064009-19064031 CATGCTCAGGAGCAGGCTGCAGG - Intronic
1180910866 22:19448972-19448994 GACACTGAGAGGAAGGCTGCAGG + Intergenic
1182171625 22:28235867-28235889 CATACAAAGAAGAGGGTTCCAGG - Intronic
950713421 3:14830128-14830150 CATAATAACAGGAAGGCTCCTGG - Intronic
952995166 3:38872901-38872923 CAAACTAAGAAAAATGTTGCAGG - Intronic
956935544 3:74096667-74096689 CAGACTAAGATGCAGGGTGCAGG + Intergenic
958119063 3:89261319-89261341 CATACAAAGAACAAGGCAGGAGG - Intronic
960681034 3:120247704-120247726 CATACTTAGGAGAAGACTGGGGG - Intronic
965194951 3:165582042-165582064 CTTCCTAAGAACAATGCTGCTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966469203 3:180269809-180269831 CATATGAAGAAGAATGCAGCTGG - Intergenic
969633954 4:8354463-8354485 CAAACTAATACGAAGGCTGAAGG + Intergenic
971503388 4:27340850-27340872 AATAATAACAGGAAGGCTGCTGG + Intergenic
975299278 4:72770792-72770814 CATACTGAAAAGAAGACTGATGG - Intergenic
975570269 4:75809718-75809740 CATAGTGAGAAGAAGAATGCTGG - Intronic
980244942 4:130226720-130226742 GATACTAAGAAGATAGCTGAAGG - Intergenic
980330678 4:131407378-131407400 CATTTTAAGAATAAGTCTGCAGG + Intergenic
985018043 4:185657799-185657821 CATTTTATGAAGAAGGCTGAGGG + Intronic
986516633 5:8571409-8571431 CATATCAAGGAGGAGGCTGCTGG - Intergenic
986999404 5:13644340-13644362 CATAGTAAGAAAATGGATGCTGG + Intergenic
988000925 5:25347355-25347377 AATCCTAAAAAGAATGCTGCTGG + Intergenic
990967583 5:61465634-61465656 AATACTGAGCAGAATGCTGCTGG + Intronic
991449105 5:66732855-66732877 AATACTAAGAAGAAAGCTAAAGG - Intronic
992717889 5:79529644-79529666 CTGACTGAGAAGAAAGCTGCTGG + Intergenic
993879324 5:93344368-93344390 CATGCCAAGAAGAAGGGTGAAGG - Intergenic
994571357 5:101518006-101518028 CACACTAAGATCAAAGCTGCAGG + Intergenic
998526175 5:142845296-142845318 CATCCTTAGAAGAATGCTTCCGG + Intronic
1001592542 5:172875464-172875486 GATAATAAGCAGAAGCCTGCTGG - Intronic
1001637964 5:173226270-173226292 CAGGCCAAGAAGAAAGCTGCTGG - Intergenic
1004773723 6:18817998-18818020 CATAATAAGGAAAATGCTGCTGG + Intergenic
1005001620 6:21247573-21247595 CAAACAAAAAAAAAGGCTGCAGG - Intergenic
1005792164 6:29314325-29314347 CGTACTAAAAAGAAGCATGCTGG + Intergenic
1005948157 6:30610227-30610249 CATCCTAGGAAGGATGCTGCTGG - Intronic
1007019136 6:38501774-38501796 CATAATAAAGAGAAGACTGCTGG - Intronic
1008536855 6:52512713-52512735 CACACCAAAAGGAAGGCTGCTGG - Intronic
1008733583 6:54514134-54514156 CATACTAATAATAAAACTGCAGG - Intergenic
1012032566 6:94090861-94090883 CATACTAAAAAGAGGGCAGGTGG - Intergenic
1012183596 6:96186435-96186457 CATACTAAGAAGAAGGCTGCAGG - Intronic
1014814606 6:125921548-125921570 CATACTACTAAGAAGTCAGCAGG - Intronic
1018199756 6:161383912-161383934 CAAACTAAAAAGATGTCTGCTGG - Intronic
1018813941 6:167317176-167317198 GGTAACAAGAAGAAGGCTGCTGG - Intergenic
1023401962 7:39797262-39797284 CATACTGAGTAGAAGGCTTTGGG + Intergenic
1024647658 7:51383400-51383422 CATACTGAGTAGAAGGCTTTGGG - Intergenic
1025176841 7:56806437-56806459 CATACTGAGTAGAAGGCTTTGGG - Intergenic
1025694951 7:63769949-63769971 CATACTGAGTAGAAGGCTTTGGG + Intergenic
1026152634 7:67801229-67801251 AATAATAAAAAGAAGGCTCCAGG + Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1030080620 7:105774651-105774673 CTTATTAATGAGAAGGCTGCGGG - Intronic
1032052474 7:128657654-128657676 CATACTGAGTAGAAGGCTTTGGG + Intergenic
1033267174 7:139896338-139896360 CAAACTAACAAGAGGGCAGCCGG + Intronic
1036446833 8:8828981-8829003 CATTGTAGGAAGAAGGCTGCTGG - Intronic
1037454202 8:19047464-19047486 CATCCTAGAAAGAAGGCTGCAGG - Intronic
1038977053 8:32710931-32710953 CATACTTAGCAGAAGGCAGGAGG - Intronic
1041435419 8:57834623-57834645 CATACAAAGAATAAGGCTTTTGG + Intergenic
1042007831 8:64202003-64202025 CATATTAAGAAGTGGGCTGTGGG - Intergenic
1046676270 8:117111983-117112005 TCATCTAAGAAGAAGGCTGCAGG + Intronic
1047538925 8:125745116-125745138 CATATTTACAAGAAGGCAGCAGG + Intergenic
1048275749 8:133064688-133064710 CCTATTAAGAGGAGGGCTGCTGG - Intronic
1049326299 8:142023245-142023267 CAGACAAAGAAGGAGGCTGCTGG - Intergenic
1056210760 9:84362763-84362785 CATTCTGAGAAGAGGGCTGTAGG - Intergenic
1060747076 9:126144636-126144658 CACAAAAAAAAGAAGGCTGCAGG + Intergenic
1061510574 9:131058564-131058586 CTGTCTGAGAAGAAGGCTGCTGG + Intronic
1189886600 X:45552465-45552487 TATACTAAGAAAAATGCTGCAGG - Intergenic
1193411439 X:81168300-81168322 CATACTAGGAAGCAGGCAGTGGG + Intronic
1194566251 X:95493081-95493103 AATACTCAGAAGAAGGATACAGG + Intergenic
1196375742 X:115030764-115030786 CATTCTAACAAGCAGGCTGGAGG - Intergenic
1201413121 Y:13721247-13721269 CATATTAAAGAGGAGGCTGCAGG + Intergenic
1202381730 Y:24280031-24280053 CATACTGAGTAGAAGGCTTTGGG + Intergenic
1202489055 Y:25390095-25390117 CATACTGAGTAGAAGGCTTTGGG - Intergenic