ID: 1012187181

View in Genome Browser
Species Human (GRCh38)
Location 6:96233395-96233417
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012187181_1012187195 29 Left 1012187181 6:96233395-96233417 CCATCTACCTTCTTCTAATCCAG No data
Right 1012187195 6:96233447-96233469 CCTTCACGGACCAGTGGGTTAGG No data
1012187181_1012187190 23 Left 1012187181 6:96233395-96233417 CCATCTACCTTCTTCTAATCCAG No data
Right 1012187190 6:96233441-96233463 TGCACCCCTTCACGGACCAGTGG No data
1012187181_1012187188 15 Left 1012187181 6:96233395-96233417 CCATCTACCTTCTTCTAATCCAG No data
Right 1012187188 6:96233433-96233455 CATTTCCATGCACCCCTTCACGG No data
1012187181_1012187191 24 Left 1012187181 6:96233395-96233417 CCATCTACCTTCTTCTAATCCAG No data
Right 1012187191 6:96233442-96233464 GCACCCCTTCACGGACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012187181 Original CRISPR CTGGATTAGAAGAAGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr