ID: 1012198286

View in Genome Browser
Species Human (GRCh38)
Location 6:96372707-96372729
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012198283_1012198286 17 Left 1012198283 6:96372667-96372689 CCTTAAATCAAATCAAATAAATC No data
Right 1012198286 6:96372707-96372729 CTGTGGTTCAGGAAGTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012198286 Original CRISPR CTGTGGTTCAGGAAGTGAAC AGG Intergenic
No off target data available for this crispr