ID: 1012200557

View in Genome Browser
Species Human (GRCh38)
Location 6:96400941-96400963
Sequence AATTATGTAACATCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012200557_1012200560 23 Left 1012200557 6:96400941-96400963 CCTTTATGTGATGTTACATAATT No data
Right 1012200560 6:96400987-96401009 AATTAAAATTCAACCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012200557 Original CRISPR AATTATGTAACATCACATAA AGG (reversed) Intergenic
No off target data available for this crispr