ID: 1012203551

View in Genome Browser
Species Human (GRCh38)
Location 6:96435414-96435436
Sequence CTGTAGCCCCTGTTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012203545_1012203551 -7 Left 1012203545 6:96435398-96435420 CCTTGGGCAGGGCCTGCTGTAGC No data
Right 1012203551 6:96435414-96435436 CTGTAGCCCCTGTTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012203551 Original CRISPR CTGTAGCCCCTGTTGGGGAT GGG Intergenic
No off target data available for this crispr