ID: 1012203551 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:96435414-96435436 |
| Sequence | CTGTAGCCCCTGTTGGGGAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012203545_1012203551 | -7 | Left | 1012203545 | 6:96435398-96435420 | CCTTGGGCAGGGCCTGCTGTAGC | No data | ||
| Right | 1012203551 | 6:96435414-96435436 | CTGTAGCCCCTGTTGGGGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012203551 | Original CRISPR | CTGTAGCCCCTGTTGGGGAT GGG | Intergenic | ||
| No off target data available for this crispr | |||||