ID: 1012206244

View in Genome Browser
Species Human (GRCh38)
Location 6:96464134-96464156
Sequence CTTTTGTCATGGGGGTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012206244_1012206251 -10 Left 1012206244 6:96464134-96464156 CCCTTGAACCCCCATGACAAAAG No data
Right 1012206251 6:96464147-96464169 ATGACAAAAGGCTTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012206244 Original CRISPR CTTTTGTCATGGGGGTTCAA GGG (reversed) Intergenic
No off target data available for this crispr