ID: 1012208581

View in Genome Browser
Species Human (GRCh38)
Location 6:96492073-96492095
Sequence CTGAGCTTACAGATGGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012208581_1012208583 1 Left 1012208581 6:96492073-96492095 CCATATACCATCTGTAAGCTCAG No data
Right 1012208583 6:96492097-96492119 AAGTAAATAATTAAGCATGTAGG No data
1012208581_1012208584 28 Left 1012208581 6:96492073-96492095 CCATATACCATCTGTAAGCTCAG No data
Right 1012208584 6:96492124-96492146 TTATATAAAACACAGTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012208581 Original CRISPR CTGAGCTTACAGATGGTATA TGG (reversed) Intergenic
No off target data available for this crispr