ID: 1012211282

View in Genome Browser
Species Human (GRCh38)
Location 6:96521724-96521746
Sequence CGCTTGCGCCCGAGGCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 798}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012211282_1012211291 -1 Left 1012211282 6:96521724-96521746 CCCCCGCGCCTCGGGCGCAAGCG 0: 1
1: 0
2: 0
3: 28
4: 798
Right 1012211291 6:96521746-96521768 GTTTGGTGTGTCTGCGTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 128
1012211282_1012211289 -3 Left 1012211282 6:96521724-96521746 CCCCCGCGCCTCGGGCGCAAGCG 0: 1
1: 0
2: 0
3: 28
4: 798
Right 1012211289 6:96521744-96521766 GCGTTTGGTGTGTCTGCGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1012211282_1012211293 24 Left 1012211282 6:96521724-96521746 CCCCCGCGCCTCGGGCGCAAGCG 0: 1
1: 0
2: 0
3: 28
4: 798
Right 1012211293 6:96521771-96521793 GAGCCTCTTGTCCCTCTGCGCGG 0: 1
1: 0
2: 1
3: 10
4: 126
1012211282_1012211290 -2 Left 1012211282 6:96521724-96521746 CCCCCGCGCCTCGGGCGCAAGCG 0: 1
1: 0
2: 0
3: 28
4: 798
Right 1012211290 6:96521745-96521767 CGTTTGGTGTGTCTGCGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 44
1012211282_1012211292 2 Left 1012211282 6:96521724-96521746 CCCCCGCGCCTCGGGCGCAAGCG 0: 1
1: 0
2: 0
3: 28
4: 798
Right 1012211292 6:96521749-96521771 TGGTGTGTCTGCGTCGGGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 336
1012211282_1012211288 -4 Left 1012211282 6:96521724-96521746 CCCCCGCGCCTCGGGCGCAAGCG 0: 1
1: 0
2: 0
3: 28
4: 798
Right 1012211288 6:96521743-96521765 AGCGTTTGGTGTGTCTGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012211282 Original CRISPR CGCTTGCGCCCGAGGCGCGG GGG (reversed) Intronic
901482938 1:9538806-9538828 CGCTTGAGCCCGGGAGGCGGGGG - Intergenic
901902943 1:12382183-12382205 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
902031014 1:13422308-13422330 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
902040686 1:13490240-13490262 CGCTTGAACCCGAGAGGCGGAGG - Intronic
902225015 1:14991269-14991291 CGCTTGAACCCGAGAGGCGGGGG + Intronic
902350029 1:15847648-15847670 CGCGCGCGCCCGCGGCGAGGGGG + Intergenic
902375186 1:16027144-16027166 GGCTTGCGCCCTGGGCGGGGAGG - Intronic
902587410 1:17448924-17448946 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
903349924 1:22711212-22711234 CGCGGGCGCCCGGGGAGCGGCGG + Intronic
903395038 1:22994549-22994571 CGCTTGAACCCGGGACGCGGAGG - Intergenic
903635181 1:24808758-24808780 CGCTTGAACCCGAGAGGCGGAGG - Intronic
903748227 1:25602883-25602905 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
903943726 1:26949022-26949044 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
904487346 1:30835660-30835682 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
904513580 1:31035307-31035329 CACTTGAGCCCGAGAGGCGGAGG + Intronic
905427951 1:37899095-37899117 CGCTTGAACCCGAGAGGCGGAGG + Intronic
905437553 1:37967774-37967796 CGCTTGCGCCCGGGAGGCAGAGG + Intronic
905564664 1:38954311-38954333 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
905574439 1:39032073-39032095 CGCTTGAACCCGAGAGGCGGAGG + Intronic
905778576 1:40687516-40687538 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
906119512 1:43379418-43379440 CGCTTGAGCCTGAGAGGCGGAGG + Intergenic
906404618 1:45531830-45531852 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
906405889 1:45541668-45541690 CGCTTGAACCCGAGGGGCAGAGG + Intergenic
906508136 1:46395021-46395043 CGCTTGCACCCGGGAGGCGGAGG - Intronic
906538286 1:46564558-46564580 CGCTTGAACCCGAGGGGTGGAGG - Intronic
906540430 1:46581424-46581446 CGCTTGAACCCGAGAGGCGGAGG + Intronic
907123405 1:52027914-52027936 CGCTTGAGCCCGAGAGGCGGAGG - Intronic
907389162 1:54145340-54145362 CGCTTGCACCCGGGAGGCGGAGG + Intronic
908142213 1:61197895-61197917 CGCTTGAACCCGAGAGGCGGAGG + Intronic
909610696 1:77548957-77548979 CGCTTGACCCCGAGAGGCGGAGG - Intronic
909809747 1:79917816-79917838 CGCTTGAACCCGAGAAGCGGAGG + Intergenic
910186305 1:84544642-84544664 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
910758980 1:90717484-90717506 CGACTGCGCACGTGGCGCGGCGG + Intergenic
910818371 1:91317328-91317350 CGCTTGAACCCGAGAGGCGGAGG + Intronic
910877089 1:91887333-91887355 CGCTTGAGCCTGAGAAGCGGAGG - Intronic
910911382 1:92238011-92238033 CACTTGAGCCCGAGAGGCGGAGG - Intronic
912318261 1:108686259-108686281 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
912404036 1:109421377-109421399 CACTTGAACCCGAGGGGCGGAGG + Intronic
912434972 1:109655422-109655444 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
912830268 1:112946635-112946657 TGCTTGAGCCCGAGGGGCGGAGG - Intronic
912983623 1:114403452-114403474 CGCTTGAACCCGAGAGGCGGAGG - Intronic
913031074 1:114903094-114903116 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
914424287 1:147560521-147560543 CGCTTGAACCCGAGAGGCGGAGG + Intronic
914665282 1:149827598-149827620 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
914670483 1:149866223-149866245 CGCTTGAACCCGAGAGGCGGAGG - Intronic
914749925 1:150527764-150527786 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
914785249 1:150823632-150823654 CGCTTGAACCCGAGGGGTGGTGG - Intronic
915135222 1:153727269-153727291 CGCTTGCACCCGGGAGGCGGAGG - Intergenic
915205525 1:154267971-154267993 CGCTTGAACCCGAGAGGCGGAGG - Intronic
915298113 1:154936163-154936185 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
915317953 1:155040217-155040239 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
915590814 1:156869153-156869175 CGCTTGAACCCGAGAGGCGGAGG - Intronic
915831463 1:159134746-159134768 CACTTGAGCCCGAGAGGCGGAGG + Intronic
915934784 1:160084076-160084098 CGCTGGCGGCCGCGGCGCCGCGG - Exonic
916228738 1:162517799-162517821 CGCTTGAACCCGAGAGGCGGAGG + Intronic
916242445 1:162653491-162653513 CGCTTGAACCCGAGAGGCGGAGG + Intronic
918264665 1:182830721-182830743 CGCTTGAGCCCGGGAAGCGGAGG + Intergenic
918291636 1:183114151-183114173 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
919093585 1:193002498-193002520 CGCTTGTGCCCGAGAGGCGGAGG - Intergenic
919429594 1:197475991-197476013 CGCTTGAACCCGAGATGCGGAGG - Intronic
919486628 1:198155709-198155731 CGCTTGAACCCGAGGCGGGGAGG - Intergenic
919682101 1:200445784-200445806 CGCTTGAGCCCAAGAGGCGGAGG - Intergenic
919928605 1:202206999-202207021 CGCTTGAACCCGAGAGGCGGAGG - Intronic
920149165 1:203890389-203890411 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
920155166 1:203943707-203943729 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
920712852 1:208311438-208311460 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
920767378 1:208846419-208846441 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
921844368 1:219863169-219863191 CGCTTGAACCCGAGGTGGGGGGG + Intronic
921917263 1:220626736-220626758 CGCTTGCACCCTAGAGGCGGAGG + Intronic
922294751 1:224240149-224240171 CGCTTGAACCTGAGGGGCGGAGG - Intronic
922424856 1:225483328-225483350 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
922821079 1:228486424-228486446 CGCTTGAACCCGGGACGCGGAGG + Intergenic
924307186 1:242701957-242701979 CGCTTGAACCTGAGGGGCGGAGG - Intergenic
924363729 1:243267516-243267538 CGCTTGAACCCGAGAGGCGGAGG + Intronic
924562031 1:245164985-245165007 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
924596365 1:245448289-245448311 CGCTTGCACCTGAGTGGCGGAGG - Intronic
924701901 1:246462566-246462588 CCCTTGACCCCGAGGCTCGGAGG + Intronic
924728395 1:246690674-246690696 GGCTTGAGCCCGAGAGGCGGAGG + Intergenic
924864806 1:247967310-247967332 CGCTTGAACCCGAGGGGCAGAGG - Intronic
1062803525 10:397444-397466 CGCTTGAACCCGAGGGGCAGAGG + Intronic
1063399442 10:5728135-5728157 CGCTTGAGCCCGAGACGTGGAGG + Intronic
1063638958 10:7812770-7812792 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1063686797 10:8244699-8244721 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1064098609 10:12443711-12443733 CGCTTGAACCCGGGGAGCGGAGG - Intronic
1065081971 10:22138161-22138183 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1065435965 10:25703952-25703974 CGCTTGAACCCGAGAAGCGGAGG + Intergenic
1066121901 10:32297363-32297385 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1066287940 10:33986990-33987012 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1067105896 10:43366140-43366162 CGCTTGAACCCGAGACGAGGAGG + Intergenic
1067444789 10:46334810-46334832 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1067502010 10:46814122-46814144 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1067592577 10:47525886-47525908 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1067639693 10:48033971-48033993 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1067873804 10:49986334-49986356 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1067984661 10:51129359-51129381 CGCTTGAACCCGAGAGGCGGGGG + Intronic
1068308073 10:55241130-55241152 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1069222893 10:65906102-65906124 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1069229322 10:65989022-65989044 CGCTTGAACCCGAGAAGCGGAGG - Intronic
1069439533 10:68415735-68415757 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1069445763 10:68471954-68471976 CGCATGCGCGCGAGGTGCGCAGG - Intronic
1069463731 10:68619311-68619333 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1069582143 10:69573376-69573398 CGCTCTCTCTCGAGGCGCGGCGG + Intergenic
1069693107 10:70367238-70367260 CGCTTGAGCCCAGGGGGCGGAGG + Intronic
1069951157 10:72019066-72019088 CGCTTGAGCCTGAGAGGCGGAGG + Intergenic
1069987146 10:72292174-72292196 CGCTTGAACCCGAGTGGCGGAGG + Intergenic
1070123485 10:73600828-73600850 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1070136668 10:73700075-73700097 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1070254152 10:74799498-74799520 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1070356443 10:75645064-75645086 CGCTTGAGCCCAAGAGGCGGAGG - Intronic
1070531018 10:77337534-77337556 CGCTTGAGCCCGAGAGGCGGAGG + Intronic
1071300996 10:84256150-84256172 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1071597520 10:86939076-86939098 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1071680509 10:87700572-87700594 CGCTTGAGCCGGAGACGTGGAGG + Intronic
1072003563 10:91220798-91220820 CGCTGGCGGGCGAGGAGCGGCGG + Intronic
1072169787 10:92848411-92848433 CGCTCGGGCCGGCGGCGCGGGGG - Intronic
1072604694 10:96970312-96970334 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1073124341 10:101140346-101140368 CGCTGGGACCCGCGGCGCGGCGG + Intergenic
1074970743 10:118534547-118534569 CGCTTGAGCCCAAGAGGCGGAGG - Intergenic
1075745030 10:124721116-124721138 CGCTTGAGTCCGAGAAGCGGAGG + Intronic
1076505806 10:130971871-130971893 CGCTTGAACCCGATGGGCGGAGG - Intergenic
1077027540 11:447896-447918 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1077053904 11:580770-580792 CGCTTGCACCTGAGAGGCGGAGG - Intronic
1077069749 11:663362-663384 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1077623259 11:3746827-3746849 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1078252490 11:9627718-9627740 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1079076543 11:17388494-17388516 CGCTTGAACCCGAGAGGCGGAGG + Exonic
1079225347 11:18600285-18600307 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
1079602714 11:22329168-22329190 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1079917182 11:26383979-26384001 CACTTGCACCCGAGAAGCGGAGG - Intronic
1080433265 11:32217576-32217598 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1080580568 11:33639621-33639643 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1080621176 11:33988452-33988474 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1081536463 11:44000206-44000228 CGCTTGCACCCGGGAGGCGGAGG - Intergenic
1081943727 11:46968813-46968835 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1081983288 11:47283653-47283675 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1082100782 11:48171383-48171405 CGCTTGAGCCCGAGAAGCAGAGG - Intergenic
1082846842 11:57733337-57733359 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1083237863 11:61363151-61363173 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1083554187 11:63613325-63613347 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1083557086 11:63638619-63638641 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1083563067 11:63689839-63689861 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1083693148 11:64423826-64423848 CACTTGCGCCCGGGAGGCGGAGG + Intergenic
1083982479 11:66184227-66184249 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1084124325 11:67089059-67089081 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1084379932 11:68805365-68805387 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1084597429 11:70125257-70125279 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1084606917 11:70177681-70177703 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1084620167 11:70264491-70264513 CGCTTGAACCCGGGACGCGGAGG - Intergenic
1084626168 11:70309251-70309273 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1084737060 11:71112307-71112329 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1084753648 11:71221115-71221137 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1084867920 11:72074948-72074970 CACTTGAGCCCGAGAGGCGGAGG + Intronic
1084969859 11:72765180-72765202 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1085579150 11:77635433-77635455 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1085676179 11:78520972-78520994 CGCTTGAACCCGAGACGCAGGGG + Intronic
1086340856 11:85846815-85846837 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1086485340 11:87294465-87294487 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1087574325 11:99971457-99971479 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1088027115 11:105198908-105198930 CGCTTGCGCCCAGGAGGCGGAGG + Intergenic
1088083424 11:105948687-105948709 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1088290603 11:108232944-108232966 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1088624022 11:111715883-111715905 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1088967446 11:114738001-114738023 CGCTTGAGCCCGGGGGGCGGAGG + Intergenic
1089603103 11:119627019-119627041 GGCTTGCACCCCAGGCGAGGGGG + Intronic
1090924536 11:131237697-131237719 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1091459250 12:631445-631467 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1091723344 12:2828756-2828778 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1091908102 12:4205751-4205773 CGCTTGAACCCGGGGCGGGGAGG - Intergenic
1092072661 12:5645303-5645325 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1092203917 12:6604189-6604211 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1092335548 12:7629426-7629448 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1092804147 12:12203682-12203704 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1092821933 12:12360802-12360824 CACTTGAGCCCGAGAGGCGGAGG - Intronic
1092868701 12:12786937-12786959 CGCATGGGCCCGACGCGCTGCGG + Exonic
1093060121 12:14593523-14593545 CGCTTGAGCCTGAGAAGCGGAGG - Intergenic
1093972683 12:25389457-25389479 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
1094156753 12:27345570-27345592 CACTTGAGCCCAAGGCGTGGAGG - Intronic
1094562829 12:31571699-31571721 CGCTTGAGCCCGAGAGGTGGAGG - Intronic
1094772159 12:33675581-33675603 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1095756387 12:45771272-45771294 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1096313133 12:50539530-50539552 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1096820407 12:54229364-54229386 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
1097890242 12:64770785-64770807 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1098742202 12:74187362-74187384 CGCTTGAGCCCGAGAGGCGGAGG - Intergenic
1098925910 12:76349133-76349155 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1099330457 12:81278455-81278477 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1100262606 12:92947308-92947330 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1100418358 12:94402813-94402835 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1101000012 12:100347933-100347955 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1101149738 12:101873792-101873814 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1102073670 12:110042994-110043016 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1102073859 12:110044459-110044481 CGCTTGAACCCCAGACGCGGAGG + Intronic
1102103087 12:110296196-110296218 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1102280857 12:111617809-111617831 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1102306395 12:111807958-111807980 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1102367976 12:112355678-112355700 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1102408919 12:112700151-112700173 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1102417185 12:112773999-112774021 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1102534288 12:113569390-113569412 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1102958838 12:117078380-117078402 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1103372619 12:120430887-120430909 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1103397055 12:120616083-120616105 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1103406161 12:120677169-120677191 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1103529411 12:121590146-121590168 CGCTTGTACCCGAGAGGCGGAGG + Intergenic
1103602971 12:122065774-122065796 CGCTTGAGCCCCAGAGGCGGAGG - Intergenic
1104459299 12:128941654-128941676 CGCTTGAACCCGGGGTGCGGAGG - Intronic
1105241957 13:18616215-18616237 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1105372377 13:19813314-19813336 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1105422213 13:20263171-20263193 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1105936310 13:25102868-25102890 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1107622739 13:42250052-42250074 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1108234494 13:48389074-48389096 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1108331891 13:49395317-49395339 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1108400671 13:50039075-50039097 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1110243499 13:73294803-73294825 CGCTTGAGCCCCAGACGTGGAGG - Intergenic
1111169527 13:84507815-84507837 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1111817992 13:93178771-93178793 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1112010930 13:95293272-95293294 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1112353732 13:98657400-98657422 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1112368435 13:98774585-98774607 CGCTTGAGCCCGAGAGGCGAAGG + Intergenic
1112749693 13:102569330-102569352 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1113147832 13:107228701-107228723 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1113470263 13:110539641-110539663 CGCTTGAGCCCGGGAAGCGGAGG - Intronic
1113490908 13:110691097-110691119 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1114285845 14:21242398-21242420 CGCTTGAACCCAAGACGCGGAGG + Intronic
1114340090 14:21734114-21734136 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1115601721 14:34961746-34961768 TGCTTGAACCCGAGGAGCGGAGG - Intergenic
1115761336 14:36581177-36581199 CGCTCGCGCTCCAGGGGCGGCGG - Exonic
1116903755 14:50385718-50385740 CGCTTGAGCCCAAGGGGTGGAGG + Intronic
1117861741 14:60098852-60098874 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1118106330 14:62663985-62664007 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1118170534 14:63384777-63384799 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1118197474 14:63641012-63641034 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1118293489 14:64547490-64547512 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1118552742 14:66973673-66973695 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1118575687 14:67239770-67239792 CGCTTGAACCCGGGGAGCGGAGG + Intergenic
1118828790 14:69409420-69409442 CGCTTGGGCCCAGGGTGCGGAGG - Intronic
1119227150 14:72953082-72953104 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1119438478 14:74612658-74612680 CGCTTGCGCCCTGGCCGCTGGGG + Intergenic
1119487714 14:75002733-75002755 CTCCAGCCCCCGAGGCGCGGGGG + Intergenic
1119823703 14:77640149-77640171 CGCTTGAGCCCGGGAAGCGGAGG + Intergenic
1121189706 14:92015572-92015594 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1121284287 14:92723128-92723150 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1121342952 14:93115899-93115921 CGCTTGAGCCCGCGGCGGCGAGG + Intronic
1122083518 14:99283679-99283701 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1122226876 14:100285509-100285531 CGCGGGGACCCGAGGCGCGGTGG + Intergenic
1122334365 14:100960088-100960110 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1122454203 14:101837225-101837247 CGCTTGAACCCAAGGGGCGGAGG - Intronic
1122467823 14:101946421-101946443 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1122606627 14:102950880-102950902 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1122749124 14:103919908-103919930 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1123053207 14:105557471-105557493 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1123077781 14:105677883-105677905 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1123693884 15:22862983-22863005 CGCTTGAGCCCGAGAGGCAGAGG - Intronic
1124454116 15:29824357-29824379 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1124912958 15:33940623-33940645 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1125571857 15:40726333-40726355 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1125682992 15:41544532-41544554 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1126605866 15:50475684-50475706 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1126799701 15:52287890-52287912 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1127466196 15:59247110-59247132 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1127618488 15:60710402-60710424 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1128077958 15:64840276-64840298 CGCTTGAGCCCGAAAGGCGGAGG - Intergenic
1128101478 15:65004098-65004120 CGCTTGAGCCCGGGAAGCGGAGG - Intronic
1128217237 15:65943068-65943090 CGCTTGAACCCGGGGGGCGGTGG - Intronic
1128346149 15:66853760-66853782 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1128987789 15:72233777-72233799 CGCTTGAACCCGAGACGCGGAGG + Intergenic
1130338236 15:82976379-82976401 CGCTTGAACCCGGGGTGCGGAGG - Intronic
1130526431 15:84710984-84711006 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1130931567 15:88432066-88432088 CGCTTGAGCCCGGGAAGCGGAGG + Intergenic
1131033757 15:89207512-89207534 TGCTTGCACCCGAGAGGCGGAGG - Intergenic
1131151688 15:90051153-90051175 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1131418559 15:92283448-92283470 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1131475266 15:92733166-92733188 CGCTTGCACCCCAGAGGCGGAGG + Intronic
1131494373 15:92892910-92892932 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1131653981 15:94434945-94434967 CGCTTGAACCCGAGGAGCGGAGG - Intronic
1132487703 16:203930-203952 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1132533118 16:463520-463542 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1132610199 16:812055-812077 CGCCTGCTCCTGAGGTGCGGGGG - Intronic
1132710893 16:1266756-1266778 CGCTTGCTCCAGAGGCTTGGAGG - Intergenic
1132783841 16:1643455-1643477 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1132801345 16:1755761-1755783 CGCTTGAACCCGAGACGTGGAGG + Intronic
1133196486 16:4174400-4174422 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1133196617 16:4175323-4175345 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1133261016 16:4550166-4550188 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1133375121 16:5279583-5279605 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1133790308 16:9004614-9004636 CGCTTGAGTCCAAGGGGCGGAGG - Intergenic
1134132991 16:11662412-11662434 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1134145190 16:11755124-11755146 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1134618961 16:15673291-15673313 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1134620357 16:15684145-15684167 CGCTTGTACCCGAGAGGCGGAGG + Intronic
1134878982 16:17727787-17727809 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1135068133 16:19328981-19329003 CGCTTGGGCCTGGGGGGCGGAGG - Intergenic
1135517666 16:23149153-23149175 CGCTGGCGGCGGCGGCGCGGGGG - Exonic
1135544651 16:23357497-23357519 CGCTTGAACCCCAGGGGCGGAGG + Intronic
1135773044 16:25232144-25232166 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1136407756 16:30058567-30058589 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1136504525 16:30694475-30694497 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1137531761 16:49282406-49282428 CGCGTGCGCGCGCGGCGGGGCGG + Intergenic
1137633248 16:49962962-49962984 CGCTTGGACCCGAGAGGCGGAGG + Intergenic
1137730649 16:50687179-50687201 CGCTTGAGCCCAGGGGGCGGAGG + Intergenic
1137996614 16:53222158-53222180 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1138327987 16:56191411-56191433 CGCCTGGGCCCGGGGCGGGGAGG - Intronic
1138479582 16:57293411-57293433 TGCTTGAACCCGAGGAGCGGAGG - Intergenic
1138817633 16:60221436-60221458 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1139789178 16:69418734-69418756 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1139816230 16:69675721-69675743 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1139826624 16:69762400-69762422 CGCTGGCGCGGGGGGCGCGGTGG + Intronic
1139928047 16:70502515-70502537 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1140320095 16:73942340-73942362 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1140522297 16:75592276-75592298 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1140524063 16:75607416-75607438 CGCTTGAACCCCAGGGGCGGAGG + Intronic
1140606532 16:76545949-76545971 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1140880186 16:79191135-79191157 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1141103119 16:81212366-81212388 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1141452721 16:84116638-84116660 CGGTTGCGTCCGAGGCCCCGAGG - Intronic
1141538433 16:84699828-84699850 CGCTTCCGCCCGAGGGTCGCGGG + Intergenic
1141589657 16:85060042-85060064 CGCTTGAGCCCGGGAAGCGGAGG - Intronic
1141657566 16:85424247-85424269 CGCTGGCACCGGAGGGGCGGGGG - Intergenic
1141707661 16:85676946-85676968 CGCTTGAACCCGAGAGGCGGAGG - Exonic
1142021945 16:87789307-87789329 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1142081277 16:88150224-88150246 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1142687903 17:1588300-1588322 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1142879454 17:2873017-2873039 CGCTTGAACCCGAGGGGCGGAGG + Intronic
1142930428 17:3279702-3279724 CGCTTGAACCCGAGACGTGGAGG + Intergenic
1142949847 17:3470007-3470029 CGCTTGAGCCCGAGAGGCCGAGG + Intronic
1143025352 17:3938348-3938370 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1143068281 17:4267011-4267033 CGCTTGGGCCCGGGAGGCGGAGG - Intergenic
1143494424 17:7303636-7303658 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1143509624 17:7388339-7388361 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1143555713 17:7658572-7658594 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1143607736 17:7999290-7999312 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1143744383 17:8980620-8980642 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1143833597 17:9672078-9672100 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1143901827 17:10180255-10180277 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1144550017 17:16232192-16232214 CGCTTGCACCTGAGAGGCGGAGG + Intronic
1144553078 17:16258585-16258607 CGCTTGGGCCCGGGAGGCGGAGG - Intronic
1145026572 17:19472158-19472180 CACTTGAACCCGAGGGGCGGAGG + Intergenic
1145031277 17:19507141-19507163 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1145110982 17:20161125-20161147 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1146071686 17:29688092-29688114 CGCTTGAACCCGGGGGGCGGGGG - Intronic
1146238435 17:31189843-31189865 CGCTTGAACCCGAGAGGCGGGGG - Intronic
1146784254 17:35704945-35704967 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1146793053 17:35763811-35763833 CGCTTGAGCCCGTGAGGCGGAGG + Intronic
1147001732 17:37368186-37368208 CACTTGAACCCGAGGGGCGGAGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147943430 17:44066327-44066349 CGCATGCGCCCCGGGCGCCGCGG + Intronic
1148039637 17:44696579-44696601 CGCTTGAACCCGGGGAGCGGAGG + Intergenic
1148055665 17:44793692-44793714 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1148614371 17:48988595-48988617 CGCTTGGGAGCTAGGCGCGGTGG - Intergenic
1148885674 17:50770879-50770901 TGCTTGAGCCCGAGACGTGGAGG - Intergenic
1149648753 17:58262471-58262493 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1150542154 17:66112860-66112882 CGCTTGAACCCGAGAAGCGGAGG + Intronic
1150676630 17:67249598-67249620 CGCTTGAACCTGAGGGGCGGAGG + Intergenic
1150720580 17:67610835-67610857 CGTTTGAACCCGAGGGGCGGAGG + Intronic
1151859508 17:76749443-76749465 CGCTTACGCCCAGGACGCGGAGG + Intronic
1151942534 17:77301506-77301528 CACTTGAGCCCGAGAGGCGGAGG - Intronic
1152085065 17:78213057-78213079 CGCTTGAACCCGTGGCGGGGAGG + Intergenic
1152197705 17:78926930-78926952 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1153101624 18:1477530-1477552 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1153238172 18:3008356-3008378 CGCTTGAGCCCTAGAAGCGGAGG + Intronic
1153840122 18:8999810-8999832 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1154446994 18:14443663-14443685 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1154986337 18:21554822-21554844 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1156648277 18:39194188-39194210 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1157614034 18:48976272-48976294 CAGTTGCGCTCGAGGCGCCGAGG + Intergenic
1157649683 18:49315129-49315151 CGCTTAAGCCCGAGAGGCGGAGG + Intronic
1157768050 18:50317749-50317771 CGCTTGAACCCGAGGGGCAGAGG - Intergenic
1158058773 18:53313327-53313349 CACTTGTACCCGAGACGCGGAGG - Intronic
1158375937 18:56867106-56867128 CGCTTGAGCCCAGGGGGCGGAGG - Intronic
1158579808 18:58671547-58671569 CGCTCGCCTCCGAGCCGCGGAGG - Exonic
1159086135 18:63794025-63794047 CGCTTGAACCCGAGACGCAGAGG - Intronic
1160299677 18:77668526-77668548 CGCTCCCGCCAGAGGCGCTGGGG - Intergenic
1160405780 18:78645400-78645422 CGCCCGCCCCCGAGGCGCTGAGG - Intergenic
1160405794 18:78645453-78645475 CGCCTGCCCCCGAGGCGCTGAGG - Intergenic
1160617803 18:80147215-80147237 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1160668351 19:344280-344302 CGCGGGCGGCGGAGGCGCGGTGG + Intronic
1160699961 19:501399-501421 CGCTTGAACCTGAGGAGCGGAGG + Intronic
1160758094 19:768419-768441 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1160761593 19:788156-788178 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1160868594 19:1266900-1266922 CCGTTGGGGCCGAGGCGCGGGGG + Intronic
1160935407 19:1592363-1592385 CGTGTGCGCCCGGCGCGCGGAGG - Intronic
1161140029 19:2641743-2641765 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1161328424 19:3674434-3674456 CGCTTGAACCCGAGTGGCGGAGG - Intronic
1161396640 19:4048005-4048027 GGCTTGCGGCCGCGGCGCGAGGG + Exonic
1161418648 19:4162891-4162913 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1161422309 19:4182584-4182606 CGCTTCCGCCGGAAGCGGGGCGG + Exonic
1161541831 19:4856472-4856494 CGCTTGAGCCCGAGAGGCGGAGG + Intronic
1162119356 19:8453223-8453245 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1162240467 19:9349027-9349049 CGCTTGACCCCGAGAGGCGGAGG - Intronic
1162308197 19:9888438-9888460 CGCTTGAGCCTGGGGGGCGGAGG + Intronic
1162343129 19:10104007-10104029 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1162404470 19:10465302-10465324 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1162716237 19:12636279-12636301 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1162730149 19:12713620-12713642 CGCTTGAACCCGAGGGGCGGAGG + Intronic
1162802177 19:13117635-13117657 CGCTTGCACCCGGGAGGCGGTGG - Intergenic
1163010143 19:14419987-14420009 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1163012243 19:14433442-14433464 CGCGTGCGCCCCGGGCGTGGCGG - Intronic
1163048338 19:14661814-14661836 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1163088710 19:15003060-15003082 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1163353071 19:16791795-16791817 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1163740055 19:19006134-19006156 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1163866126 19:19774950-19774972 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1164136664 19:22422761-22422783 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1164275106 19:23710256-23710278 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1165002978 19:32780165-32780187 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1165356237 19:35305869-35305891 CGCTTGAGCCCGGGGGGTGGAGG + Intronic
1165471075 19:36004959-36004981 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1165534462 19:36431677-36431699 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1166103447 19:40585188-40585210 CGCTTGAGCCCGAGTGGCGGAGG - Intronic
1166206053 19:41270064-41270086 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1166310782 19:41961343-41961365 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1166576445 19:43843255-43843277 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1166892893 19:46004920-46004942 CACTTGAACCCGAGACGCGGAGG - Intronic
1167177691 19:47876991-47877013 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1167321153 19:48797898-48797920 CGCTTGGACCCGAGAGGCGGAGG - Intronic
1167678428 19:50904125-50904147 CACTTGCGGGCGGGGCGCGGTGG + Intergenic
1167680163 19:50914980-50915002 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1167955364 19:53059622-53059644 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1168324778 19:55532682-55532704 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1168698732 19:58421999-58422021 CGCTTGAACCCGGGACGCGGAGG - Intergenic
1168711786 19:58505181-58505203 CGCTTGAACCCGGGGCGCAGGGG - Intronic
925721156 2:6828874-6828896 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
926363162 2:12109185-12109207 CGCTTGAACCCGGGGAGCGGAGG + Intergenic
927479885 2:23444406-23444428 CGCTTGAACCCGAGAGGCGGAGG - Intronic
927805146 2:26140549-26140571 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
928577740 2:32673306-32673328 CGCTTGAGCCCGTGGGGCGGAGG - Intronic
928979546 2:37124049-37124071 CGCTTGAGCCCTAGGGGTGGAGG - Intronic
929197993 2:39206135-39206157 CGCTTGAACCCGGGGGGCGGAGG - Intronic
929426141 2:41846613-41846635 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
929432819 2:41902739-41902761 CGCTTGAGCCCGAGAGGTGGAGG + Intergenic
929462568 2:42114075-42114097 CGCTTGAACCCGAGACACGGAGG + Intergenic
929648798 2:43656933-43656955 CGCTTGAGCCCGAGAGGTGGAGG + Intronic
930120982 2:47760667-47760689 CGCTTGAACCCGAGAGGCGGAGG - Intronic
930609100 2:53521647-53521669 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
930814595 2:55581167-55581189 CGCTTGAACCCGAGAGGCGGAGG + Intronic
930872119 2:56181183-56181205 CGCTTGAGCCTGGGACGCGGAGG - Intergenic
931393013 2:61860897-61860919 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
932179365 2:69631894-69631916 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
932555084 2:72816073-72816095 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
932754222 2:74394729-74394751 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
933735695 2:85492162-85492184 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
934082181 2:88478303-88478325 CGCTTGAACCCGGGACGCGGAGG - Intergenic
935040020 2:99417221-99417243 CGCTTGAGCCCGAGAGGCAGAGG - Intronic
936320332 2:111461590-111461612 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
936453336 2:112650414-112650436 TGCTTGAGCCCGAGAGGCGGAGG - Intronic
938305749 2:130253048-130253070 TGCGGGCGCCCGAGGAGCGGGGG + Intergenic
938337229 2:130510814-130510836 CGCTTGATCCCGAGAGGCGGAGG + Intergenic
938352608 2:130609917-130609939 CGCTTGATCCCGAGAGGCGGAGG - Intergenic
938548767 2:132360572-132360594 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
938917988 2:135963453-135963475 CGCTTGAACCCGGGGGGCGGAGG - Intronic
940207835 2:151223747-151223769 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
940223618 2:151379014-151379036 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
940227134 2:151411484-151411506 CGCTTGAACCCGAGAGGCGGAGG - Intronic
941314941 2:163980791-163980813 CGCTTGAACCCGAGACGTGGAGG - Intergenic
942541837 2:177022733-177022755 CGCTTGCACCCCAGAGGCGGAGG + Intergenic
942584787 2:177464023-177464045 CGCTTGAACCCGGGACGCGGAGG - Intronic
943329645 2:186543434-186543456 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
943658706 2:190534933-190534955 CGCGTGCGCTGGAGGCCCGGAGG - Intergenic
943671527 2:190666623-190666645 CGCTTGAACCCGGGGCGCTGAGG + Intronic
944541207 2:200755456-200755478 CGCTTGAGCCTGGGGGGCGGAGG + Intergenic
944546821 2:200807115-200807137 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
944700880 2:202245159-202245181 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
945242432 2:207688263-207688285 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
945458033 2:210071349-210071371 CGCTTGAACCTGAGACGCGGAGG - Intronic
946324666 2:218979007-218979029 CACTTGAGCCCGAGAGGCGGAGG + Intergenic
947120673 2:226811383-226811405 CGCTTGGACCCGGGACGCGGAGG - Intergenic
947445596 2:230160479-230160501 CGCTTGAGCCTGTGGCGGGGTGG - Intergenic
947549687 2:231037518-231037540 CGGGTGCGCCCGGGCCGCGGCGG + Exonic
948419996 2:237852294-237852316 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1169044736 20:2526201-2526223 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1169801339 20:9515389-9515411 CCCTAGCGCCCGAGACGCGTGGG + Intronic
1170562150 20:17567775-17567797 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1171877596 20:30593079-30593101 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1172019788 20:31905947-31905969 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1172162855 20:32880350-32880372 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1172654160 20:36526688-36526710 TGCTTGTGCCCGATGCGGGGAGG + Intronic
1172679038 20:36697622-36697644 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1172876490 20:38167418-38167440 CGCTTGAGCCCGAGGGATGGAGG - Intergenic
1173026090 20:39308828-39308850 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1173694215 20:44993893-44993915 CGCTTGAACCCCAGGGGCGGAGG + Intronic
1173734516 20:45349646-45349668 CGTTTGAACCCGAGGGGCGGAGG + Intergenic
1174054036 20:47785763-47785785 GGCTGGGGCCCGGGGCGCGGGGG + Intronic
1174483439 20:50846695-50846717 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1174596520 20:51688506-51688528 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1174599712 20:51714463-51714485 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1174757396 20:53173522-53173544 CGCTTGAGCCCGGGGGGCAGAGG + Intronic
1176133914 20:63511058-63511080 CGCTTGAGCCCGAGAGGCAGAGG - Intergenic
1177526594 21:22299938-22299960 CGCTTGTACCCGAGAGGCGGAGG + Intergenic
1177989680 21:28021874-28021896 CGCTTGAACCCGAGAGGCGGGGG + Intergenic
1178539829 21:33439960-33439982 CACTTGAGCCCGAGAAGCGGAGG + Intronic
1178573281 21:33761157-33761179 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1178864982 21:36320014-36320036 CGCATGCGCCCTAGGCCCGCAGG + Intergenic
1179679578 21:43009359-43009381 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1179807199 21:43847128-43847150 TGCTTGAGCCCGAGAGGCGGAGG + Intergenic
1180223298 21:46373811-46373833 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1180241001 21:46505523-46505545 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1181569730 22:23761787-23761809 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1183441393 22:37825022-37825044 CGGCGGCGGCCGAGGCGCGGCGG + Exonic
1183444335 22:37843337-37843359 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1183525919 22:38322653-38322675 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1183637669 22:39074563-39074585 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1184205454 22:42999582-42999604 CGCTTGAACCCGGGACGCGGAGG + Intronic
1184212863 22:43046751-43046773 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1184440577 22:44510394-44510416 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1184485712 22:44777777-44777799 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1184597840 22:45524998-45525020 CGCTTGAACCCGAGACGCAGAGG + Intronic
949190989 3:1248734-1248756 CGCTTGAACCCGAGAGGCGGAGG + Intronic
949495784 3:4630667-4630689 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
949819978 3:8105652-8105674 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
950292089 3:11792975-11792997 CGCTTGAGCCCGGGAAGCGGAGG + Intronic
951213314 3:19999463-19999485 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
951216385 3:20029421-20029443 CCCTTGAGCCCGAGAGGCGGAGG - Intergenic
951556844 3:23929508-23929530 CGCTTGAGCCGGAGACGCAGAGG - Intronic
952168297 3:30776000-30776022 CGCTTGAACCCGAGAGGCGGAGG + Intronic
952232549 3:31447312-31447334 CGCTTGAGCCCGGGAAGCGGAGG - Intergenic
952392120 3:32889670-32889692 CGCTTGAACCCGAGAGGCGGAGG - Intronic
952811608 3:37409376-37409398 CGCTTGAACCCTAGGGGCGGAGG - Intronic
953518551 3:43620679-43620701 CGCTTGAACCCGAGAGGCGGAGG + Intronic
953959062 3:47253237-47253259 CGCTTGTGCCTGAGGGGCAGTGG - Intronic
954029515 3:47808657-47808679 CGCTTGAACCCGAGAAGCGGAGG - Intronic
954255525 3:49402951-49402973 CGCTTGAACCCGAGAGGCGGAGG + Intronic
954264927 3:49464501-49464523 CGCTTGGGCCCGGGAGGCGGAGG + Intergenic
955055557 3:55452309-55452331 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
955292723 3:57707342-57707364 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
956574908 3:70741568-70741590 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
956775326 3:72560294-72560316 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
957342726 3:78921868-78921890 CGCTTGAACCCGAGAGGCGGAGG - Intronic
958809362 3:98841979-98842001 CGCTTGAACCCGAGAGGCGGAGG + Intronic
959530738 3:107431549-107431571 CGCTTCCGCCCGAGCCCCGGCGG - Intergenic
960159891 3:114339109-114339131 CGCTGGCCCCCCAGGCGTGGTGG - Exonic
960377828 3:116925171-116925193 CGCTTGAACCCGAGAGGCGGAGG - Intronic
962499644 3:135977781-135977803 CGCTTGAGCCCGGGAAGCGGAGG - Intronic
962808878 3:138945715-138945737 CGCGGGCGCCGGGGGCGCGGCGG + Exonic
963200503 3:142581201-142581223 CGCTTGACCCCGAGAGGCGGAGG + Intergenic
963502940 3:146151411-146151433 CGCTTGAACCCGAGAGGCGGAGG + Intronic
963780799 3:149484465-149484487 CGCTTGAGCCCGAGAGGCAGAGG - Intronic
963791063 3:149583047-149583069 CGCTTGAACCTGAGGGGCGGAGG - Intronic
964121952 3:153194371-153194393 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
964324277 3:155529848-155529870 CGCTTGAACCCGGGGGGCGGAGG - Intronic
964747267 3:160024030-160024052 CGCTTGAGCCCCAGAAGCGGAGG + Intronic
965427611 3:168546700-168546722 CACTTGAGCCCGAGAGGCGGAGG - Intergenic
965567926 3:170140675-170140697 CGCTTGCACCCGAGATGTGGAGG - Intronic
965582408 3:170283019-170283041 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
965598786 3:170434902-170434924 CGCTTGAACCCAAGGGGCGGAGG - Intronic
965747090 3:171937090-171937112 CGCTTGCACCCGGGGGGCAGAGG + Intronic
965962050 3:174440887-174440909 CGCTCGCGGCGGAGGCGCCGGGG + Intronic
966179600 3:177176278-177176300 CGCTTGAGCCCAGGGGGCGGAGG - Intronic
966191330 3:177274147-177274169 CGCTTGAACCCAAGGGGCGGAGG + Intergenic
966757274 3:183383316-183383338 CGCTTGAACCCGAGAGGCGGAGG - Intronic
966798140 3:183735768-183735790 CGCTTGAACCCGGGGGGCGGAGG - Intronic
966813388 3:183868492-183868514 CGCTTGAGCCTGAGACGTGGAGG - Intronic
966814024 3:183874490-183874512 CGCTTGCACCCGAGAGGTGGAGG - Intronic
966843511 3:184107749-184107771 CACTTGAGCCCGAGAGGCGGAGG + Intergenic
966926766 3:184649362-184649384 CGCTTGAGCCCGAGAGGTGGAGG + Intronic
967795814 3:193597605-193597627 CGCTTGAGCCCCAGAGGCGGAGG + Intronic
968150263 3:196332328-196332350 CGCTTGAGCCCGAGAGGCAGAGG + Intronic
968165995 3:196465832-196465854 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
968332551 3:197884236-197884258 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
968828322 4:2915738-2915760 CGCTTGAACCCGGGGGGCGGAGG + Intronic
968875364 4:3264290-3264312 CGCTTGAACCCGGGGGGCGGAGG - Intronic
969085660 4:4654440-4654462 CGCTTGAGCCCGGAACGCGGAGG + Intergenic
969186082 4:5475339-5475361 CGCTTGAACCCGAGAGGCGGAGG + Intronic
970509715 4:16769378-16769400 CGCTTGAACCCAAGGGGCGGAGG - Intronic
970616915 4:17776470-17776492 CGCTTGAACCCGAGAGGCGGAGG - Intronic
971757135 4:30719834-30719856 CGCTGCAGCCCGAGGGGCGGCGG + Intergenic
972313874 4:37907462-37907484 CGCTTGAACCCGAGAGGCGGAGG - Intronic
972423866 4:38914480-38914502 CGCTTGAACCCGTGGGGCGGAGG + Intronic
972475285 4:39444071-39444093 CGCTTGAACCCGGGGGGCGGAGG + Intronic
972512870 4:39785951-39785973 CGCTTGAACCCCAGGAGCGGAGG + Intergenic
972564874 4:40260671-40260693 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
972658692 4:41092603-41092625 CGCTTGAACCCGAGAGGCGGAGG + Intronic
972811147 4:42587389-42587411 CGCTTGAACCCGAGAGGCGGAGG - Intronic
973199806 4:47487143-47487165 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
973243083 4:47979235-47979257 CGCTTGAGCCCAAGAGGCGGAGG + Intronic
973841405 4:54864707-54864729 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
973954192 4:56047472-56047494 CGCTTGAACCCGGGACGCGGAGG - Intergenic
974017548 4:56662561-56662583 CGCTTGAACCCGGGGGGCGGAGG - Intronic
975122703 4:70746258-70746280 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
975125657 4:70779664-70779686 CACTTGAGCCCGGGGGGCGGGGG - Intronic
975129765 4:70821520-70821542 CGCTTGAACCCGGGGGGCGGAGG + Intronic
977226935 4:94403387-94403409 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
977865878 4:102026736-102026758 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
978098463 4:104807904-104807926 CGCTTGAACCCGGGGAGCGGAGG - Intergenic
978387511 4:108190790-108190812 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
979237117 4:118413716-118413738 GGCTTGAGCCCGTGGAGCGGAGG - Intergenic
980929671 4:139173672-139173694 CGCTTGAACCCGAGAGGCGGAGG + Intronic
980930682 4:139179477-139179499 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
981223123 4:142260066-142260088 CGCTTGAACCCGAGGGGCGGAGG - Intronic
981601841 4:146498199-146498221 TGCTTGAACCCGGGGCGCGGAGG - Intronic
981967122 4:150617556-150617578 CGCTTGAACCCGAGAGGCGGAGG + Intronic
982002525 4:151034073-151034095 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
982135979 4:152274635-152274657 CGCTTGAGCCCGAGAGGTGGAGG - Intergenic
982161768 4:152577445-152577467 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
982451781 4:155561446-155561468 CGCTTGAACCCGAGGGGCGGAGG - Intergenic
982766778 4:159357597-159357619 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
983200946 4:164860080-164860102 CGCTTGCACCTGAGGGGCGGAGG + Intergenic
983526069 4:168761542-168761564 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
984667038 4:182440194-182440216 CGCTTGAACCCGAGAGGCGGAGG - Intronic
985022700 4:185709099-185709121 CGCTTGAACCCGAGAGGCGGAGG - Intronic
985342276 4:188967844-188967866 CGCTTGTACCCGAGAGGCGGAGG + Intergenic
985580506 5:693308-693330 CGCGCGCGGCCGAGTCGCGGAGG - Exonic
986321348 5:6634241-6634263 CGCTTGAACCCGAGAGGCGGAGG + Intronic
987059522 5:14228785-14228807 CGCTTGAACCCGAGAGGCGGAGG + Intronic
987633210 5:20503952-20503974 CGCTTGAACCCGAGAGGCGGAGG + Intronic
989377824 5:40783673-40783695 CGCTTGAACCCGAGAGGCGGAGG + Intronic
989405614 5:41057638-41057660 CGCTTGAACCCGAGAGGCGGAGG - Intronic
989588257 5:43089859-43089881 CGCTTGATCCCGAGGGGCAGAGG - Intronic
990471658 5:56121454-56121476 CGCTTGAACCCCAGGGGCGGAGG - Intronic
990817602 5:59803380-59803402 CGCTTGAACCCGGGGGGCGGAGG - Intronic
990846501 5:60146128-60146150 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
991053824 5:62301019-62301041 CGCTTGAGCCCCAGAGGCGGAGG + Intergenic
991617624 5:68513494-68513516 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
992395927 5:76369662-76369684 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
992674847 5:79095675-79095697 CGCTTGAGCCCGAGAGGTGGAGG + Intronic
992682549 5:79167317-79167339 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
992776322 5:80092161-80092183 CGCTTGAACCCGGGGAGCGGAGG + Intergenic
992796445 5:80258307-80258329 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
995491751 5:112700231-112700253 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
996048164 5:118899883-118899905 CGCTTGAACCCGAGAGGCGGAGG - Intronic
996405009 5:123095503-123095525 CGCGTGCGCCCTAGGCGGGGAGG - Intronic
996903643 5:128573611-128573633 CGCTTGAGCCCGGGAAGCGGAGG - Intronic
998108782 5:139485345-139485367 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
998225328 5:140322488-140322510 CGCTTGAACTCGAGGGGCGGAGG - Intergenic
998306181 5:141079012-141079034 CGCTTGAGCTCGGGGGGCGGAGG + Intergenic
998623446 5:143819549-143819571 CGCTTGAGCTCGGGGGGCGGAGG + Intronic
998750387 5:145315151-145315173 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
999218553 5:149956467-149956489 CACTTGAACCCGAGGGGCGGAGG - Intergenic
999724801 5:154427743-154427765 CGCTTGAACCCGAGGGGCAGAGG + Intergenic
1000655633 5:163875074-163875096 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
1000665218 5:163986435-163986457 CACTTGAGCCCGAGAGGCGGAGG + Intergenic
1000953579 5:167514925-167514947 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1001064300 5:168523826-168523848 CGCTTGAGCCCGAGAGGTGGAGG - Intergenic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1002280589 5:178127836-178127858 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1003077087 6:2991771-2991793 CGCTTGAACCCGGGACGCGGAGG + Intronic
1003886952 6:10530279-10530301 CGCTTGAACCCAAGGGGCGGAGG + Intronic
1003927461 6:10889702-10889724 CGCTTGAACCCGGGACGCGGAGG - Intronic
1004977403 6:20983635-20983657 CGCTTGAACCCGAGGGGCTGAGG + Intronic
1005578893 6:27214992-27215014 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1005634407 6:27739648-27739670 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1005825999 6:29632331-29632353 CGCCCGCGCCCGGGGGGCGGAGG + Exonic
1005930099 6:30476768-30476790 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1006558031 6:34886042-34886064 CGCTTGAGCCTGAGAGGCGGAGG + Intronic
1006711802 6:36080025-36080047 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1007082779 6:39120435-39120457 CGCTTGAACCCGAGAAGCGGAGG - Intergenic
1007547670 6:42706519-42706541 CACTTGAGCCCGAGACGCAGAGG + Intronic
1007900497 6:45407185-45407207 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1008611431 6:53187877-53187899 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1008939430 6:57030283-57030305 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1009881998 6:69579991-69580013 CGCTTGAACCCGGGACGCGGAGG + Intergenic
1010179281 6:73066060-73066082 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1010187880 6:73163662-73163684 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1010229662 6:73523338-73523360 CGCTTGAGCCCGGGAAGCGGAGG + Intronic
1010967250 6:82225224-82225246 CGCTTGAACCCGAGGGGCAGAGG + Intronic
1011119744 6:83938916-83938938 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1011440320 6:87380533-87380555 CGCTTGAGCCCGAGAGGCGGAGG - Intronic
1011682443 6:89796238-89796260 CACTTGAGCCCGAGACACGGAGG + Intronic
1011689768 6:89856497-89856519 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
1012211282 6:96521724-96521746 CGCTTGCGCCCGAGGCGCGGGGG - Intronic
1012913104 6:105138660-105138682 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1013153694 6:107472269-107472291 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1013239768 6:108233663-108233685 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1014442333 6:121487973-121487995 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1014636834 6:123858197-123858219 CGCTTGAACCCGGGACGCGGAGG - Intronic
1015322105 6:131887942-131887964 CGCTTGAGCCCGGGAAGCGGAGG - Intronic
1015515746 6:134081161-134081183 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1015612125 6:135034558-135034580 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1016003052 6:139061968-139061990 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1016763202 6:147763241-147763263 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1016957525 6:149640952-149640974 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1016958389 6:149648702-149648724 CGCGTGCGCCAGAGTCGCCGAGG - Exonic
1017861590 6:158403421-158403443 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1019396089 7:818945-818967 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1019544763 7:1568729-1568751 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1020183838 7:5943625-5943647 CGCTTGAGCCTGGGGGGCGGAGG - Intronic
1020225747 7:6278584-6278606 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1020248393 7:6448293-6448315 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1020299079 7:6781152-6781174 CGCTTGAGCCTGGGGGGCGGAGG + Intronic
1021031790 7:15746100-15746122 CGCTTGAGCCCGGGAGGCGGTGG + Intergenic
1021221943 7:17984857-17984879 CGCTTGGGCCCGAGAGCCGGAGG - Intergenic
1021657497 7:22886855-22886877 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1022159752 7:27697476-27697498 CGCTTGAGCCTGAGAGGCGGAGG + Intergenic
1023435915 7:40140482-40140504 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1023563146 7:41496554-41496576 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1023577702 7:41647088-41647110 AGTTTGAGCCCGAGGGGCGGAGG - Intergenic
1023815324 7:43945074-43945096 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1023917175 7:44598077-44598099 CGCTTGAACCCGGGACGCGGAGG + Intergenic
1024124604 7:46279892-46279914 CGCTTGAGCCTGAGGGGCGGAGG - Intergenic
1025091349 7:56066702-56066724 CGCTTGCACCCGGGAGGCGGAGG - Intronic
1025705767 7:63861334-63861356 CGCTTGAGCCCGCGGGGAGGAGG - Intergenic
1026019005 7:66693889-66693911 CGCTTGAGCCCCAGAGGCGGAGG - Intronic
1026309356 7:69170489-69170511 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1026510203 7:71021116-71021138 TGCTTGAGCCCGGGGAGCGGAGG + Intergenic
1026599956 7:71769768-71769790 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1026635283 7:72076512-72076534 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1026834202 7:73627330-73627352 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1027149676 7:75724038-75724060 CGCTTGAGCCCCGGGGGCGGAGG - Intronic
1027680386 7:81212952-81212974 CGCTTGAACCTGAGGGGCGGAGG + Intergenic
1028893012 7:96009861-96009883 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1029085926 7:98011730-98011752 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1029456026 7:100673047-100673069 CGCTTGCACCCGGGCGGCGGAGG + Intergenic
1029541991 7:101189032-101189054 CGCTTGCACCCGGGAGGCGGAGG + Intergenic
1029645931 7:101855792-101855814 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1030029016 7:105351718-105351740 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1030241291 7:107328902-107328924 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1031756002 7:125643378-125643400 CGCTTGAGCCCGGGAGGCGGGGG + Intergenic
1032042232 7:128572907-128572929 CGCTTGAGCCCGAGAAGCAGAGG - Intergenic
1032166885 7:129552579-129552601 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1032437158 7:131909607-131909629 CGCAGGAGCCCAAGGCGCGGGGG - Intergenic
1033214220 7:139482474-139482496 CGCTTGAACCCGAGAAGCGGAGG - Intronic
1033385969 7:140875457-140875479 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1034290770 7:149929613-149929635 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1034398344 7:150844842-150844864 CGCTTGAGCCCCAGAGGCGGAGG + Intronic
1034508619 7:151517282-151517304 CGCTTGAGTCCGGGGCGTGGAGG + Intronic
1035230178 7:157460666-157460688 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1035845210 8:2856726-2856748 CGCTTGAGCCCGGGGGGCGGAGG - Intergenic
1036461476 8:8957102-8957124 CACTTGAACCCGAGACGCGGAGG + Intergenic
1036717158 8:11136418-11136440 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1037180503 8:15999627-15999649 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1037589892 8:20303744-20303766 CAAGTGCGCCCGAGGCGCAGGGG - Exonic
1038553672 8:28491348-28491370 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1038575657 8:28701676-28701698 CGCGTGAGCCCGAGGAGCGGGGG + Intronic
1039052080 8:33504378-33504400 CGCTTGAGCCTGAGAAGCGGAGG - Intronic
1039121381 8:34151623-34151645 TGCTTGAGCCCGAGAGGCGGAGG + Intergenic
1039129531 8:34247600-34247622 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1039169097 8:34721689-34721711 CGCTTGAGCCCGGGAGGCGGGGG - Intergenic
1039541249 8:38372964-38372986 CGCTTGAACCCGGGACGCGGAGG + Intronic
1039943260 8:42109225-42109247 GGCTTGAGCCCGAGAGGCGGAGG + Intergenic
1040361542 8:46669793-46669815 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1040498587 8:47988307-47988329 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1040501663 8:48010483-48010505 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1040646979 8:49410206-49410228 CGCTTGAGCCTGAGAGGCGGAGG - Intergenic
1040869926 8:52090095-52090117 CGCTTAAGCCCCAGACGCGGAGG - Intergenic
1041089642 8:54290114-54290136 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1043443154 8:80294650-80294672 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1043453883 8:80394874-80394896 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1043477487 8:80619567-80619589 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1043874002 8:85464347-85464369 CGCGTCCGCCGGAGGCGCGTAGG + Intronic
1044318798 8:90779381-90779403 CGCTTGAGCCTGAGGGACGGAGG - Intronic
1044430726 8:92103403-92103425 CGCTCGCGCCAGGGGCGCCGCGG + Intergenic
1044678899 8:94757491-94757513 CGCTTGAGCCCGGGACGCAGAGG - Intronic
1044974556 8:97650811-97650833 CGCTTGAGCCTGAGAGGCGGAGG - Intronic
1045516500 8:102864484-102864506 CGCAGGCGCCCGAGAGGCGGCGG - Exonic
1045541338 8:103089061-103089083 CGCTTGAGCCCAGGGGGCGGAGG - Intergenic
1046044493 8:108947628-108947650 CGCTTGAACCCAAGGGGCGGAGG + Intergenic
1046543013 8:115611031-115611053 CGCTTGAGCCTGGGGGGCGGAGG + Intronic
1046588261 8:116174600-116174622 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1046594093 8:116239799-116239821 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1046662090 8:116958931-116958953 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1046948638 8:119999183-119999205 CGCTTGAACCCGAGACTCGGTGG + Intronic
1047110003 8:121779002-121779024 CGCTTGAGCCCGGGAGGCGGGGG + Intergenic
1047529727 8:125664073-125664095 CGCTTGAACCCGAGATGCGGAGG + Intergenic
1048346442 8:133579176-133579198 CGCTTGAACCCGGGGAGCGGAGG - Intergenic
1048776456 8:137952332-137952354 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1049579233 8:143403717-143403739 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1049928057 9:429049-429071 CGCTTGAGCCCAGGGCGCAGAGG - Intronic
1049972825 9:836296-836318 TGCTTGAGCCCGAGGGGCAGAGG + Intergenic
1050445850 9:5721970-5721992 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1050533623 9:6611470-6611492 CGCTTGAACCCGCGGGGCGGAGG + Intronic
1050543078 9:6686944-6686966 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1051181522 9:14416974-14416996 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1051618418 9:19028290-19028312 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1051655882 9:19380778-19380800 CGCTTGAGCCCAAGAGGCGGAGG + Intergenic
1051780496 9:20684123-20684145 CGCGTGCGCGCGAGCCGGGGAGG + Intronic
1051893234 9:21964798-21964820 CGCTTGCACCCGGGAGGCGGAGG + Intronic
1053076412 9:35138443-35138465 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1053188087 9:36036278-36036300 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1053259838 9:36652644-36652666 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1053297860 9:36927790-36927812 CGCTTGAACCCGGGGGGCGGAGG - Intronic
1053338779 9:37303745-37303767 CGCTTGCGCCTGGGAGGCGGAGG - Intronic
1053399908 9:37809747-37809769 CGCTTGAACCCGAGGGGCGGAGG + Intronic
1053522653 9:38796732-38796754 CACTTGAACCCGAGACGCGGAGG - Intergenic
1054257656 9:62831680-62831702 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1054333663 9:63784043-63784065 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1054903309 9:70392099-70392121 CGCTTGAACCCGAGGGGCGGAGG + Intronic
1055494449 9:76840895-76840917 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1056657401 9:88520599-88520621 TGCTTGAACCTGAGGCGCGGAGG + Intergenic
1056659848 9:88535595-88535617 CGCTGGTGGCCGAGGCGCGGCGG + Exonic
1056743327 9:89278995-89279017 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1057349106 9:94279554-94279576 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1057662767 9:97018108-97018130 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1058658621 9:107248434-107248456 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1058928838 9:109698359-109698381 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1059116602 9:111605240-111605262 CGCTTGGGCCTGAGAGGCGGAGG + Intergenic
1059453962 9:114388052-114388074 CGCTTCCTGCCGAGGCGAGGCGG - Intronic
1060136981 9:121166935-121166957 CGCTTGAACCCGAGAGGCGGAGG + Intronic
1061340556 9:129977073-129977095 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1061343793 9:130005423-130005445 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1061517852 9:131099808-131099830 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1061966912 9:134020069-134020091 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1185485443 X:478379-478401 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1185491910 X:524379-524401 CGCTTGAACCCGAGAGGCGGAGG - Intergenic
1187497994 X:19812889-19812911 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1187516369 X:19974796-19974818 CGCTTGAACCCGGGGGGCGGAGG + Intergenic
1187527826 X:20070030-20070052 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1187536067 X:20142586-20142608 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1187641457 X:21295428-21295450 CGCTTGAGCCCGGGAGGCGGCGG - Intergenic
1187692075 X:21879362-21879384 CACTTGAGCCCGAGGTGTGGAGG - Intronic
1187700313 X:21958758-21958780 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1187898115 X:24001718-24001740 CGCTTGAACCCGGGGGGCGGAGG + Intronic
1188073644 X:25748587-25748609 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1188250083 X:27882477-27882499 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1188353495 X:29160972-29160994 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1188619464 X:32202433-32202455 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1188829464 X:34878714-34878736 CGCTTGAACCCAAGGGGCGGAGG - Intergenic
1188887458 X:35568287-35568309 CGCTTGAACCCAGGGCGCGGAGG + Intergenic
1189069569 X:37849171-37849193 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1189391788 X:40582342-40582364 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1189749688 X:44207425-44207447 TGCTTGAGCCCGAGAGGCGGAGG + Intronic
1190098939 X:47505295-47505317 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1190267821 X:48838402-48838424 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1190275901 X:48899059-48899081 CGCTTGAGCCCGGGAGGCGGAGG - Intronic
1190565635 X:51727671-51727693 CGCTTGAACCCGAGACGTGGAGG + Intergenic
1190805855 X:53836214-53836236 CGCTTGAACCCGAGAGGCGGGGG - Intergenic
1190841372 X:54147776-54147798 CGCTTGAACCCGAGAGGCGGAGG - Intronic
1190847959 X:54211722-54211744 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1192166302 X:68829501-68829523 CGCTGCCGCACGAGGCGCGACGG - Exonic
1192444896 X:71203574-71203596 CGCTTGAGCCCGGGAGGCGGAGG + Intergenic
1193864332 X:86711291-86711313 CGCTTGAGCCCGGGAGGCGGAGG + Intronic
1197244484 X:124154361-124154383 CGCTTGTACCCGAGAGGCGGAGG - Intronic
1197803757 X:130379358-130379380 CGCTTGAACCCGAGAGGCGGAGG + Intergenic
1198269860 X:135046682-135046704 CGCTTGAGCCCGGGAGGCGGAGG - Intergenic
1198463505 X:136884696-136884718 CGCTTGAACCCGGGGGGCGGAGG - Intergenic
1199791072 X:151155786-151155808 CGCTTGAGCCTGAGGGGCAGAGG - Intergenic
1200156422 X:153978665-153978687 CGCTTGAGCCCGGGAGGCGGAGG - Intronic