ID: 1012211376

View in Genome Browser
Species Human (GRCh38)
Location 6:96522158-96522180
Sequence TTTCGCTGCAGCTGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012211376_1012211384 7 Left 1012211376 6:96522158-96522180 CCCCCAGCCCAGCTGCAGCGAAA 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1012211384 6:96522188-96522210 GCGCCCCGCCCCACCATGGACGG 0: 1
1: 0
2: 2
3: 10
4: 112
1012211376_1012211390 13 Left 1012211376 6:96522158-96522180 CCCCCAGCCCAGCTGCAGCGAAA 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1012211390 6:96522194-96522216 CGCCCCACCATGGACGGGGCCGG No data
1012211376_1012211383 3 Left 1012211376 6:96522158-96522180 CCCCCAGCCCAGCTGCAGCGAAA 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1012211383 6:96522184-96522206 TGGCGCGCCCCGCCCCACCATGG 0: 1
1: 0
2: 0
3: 13
4: 148
1012211376_1012211386 9 Left 1012211376 6:96522158-96522180 CCCCCAGCCCAGCTGCAGCGAAA 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1012211386 6:96522190-96522212 GCCCCGCCCCACCATGGACGGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1012211376_1012211385 8 Left 1012211376 6:96522158-96522180 CCCCCAGCCCAGCTGCAGCGAAA 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1012211385 6:96522189-96522211 CGCCCCGCCCCACCATGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012211376 Original CRISPR TTTCGCTGCAGCTGGGCTGG GGG (reversed) Intronic
900102318 1:967096-967118 TGTCGCTGCAGTGGGGCTTGGGG + Intronic
900557699 1:3288550-3288572 TTGGGCTGGAGCTGGGCTGGGGG - Intronic
900947089 1:5837146-5837168 TTCCGCTGCCGGTGGGCAGGAGG - Intergenic
901230930 1:7641402-7641424 TGTCCCTGGAGCTGGGCTGGAGG + Intronic
901451791 1:9340357-9340379 TGTATCGGCAGCTGGGCTGGTGG - Intronic
902232601 1:15037191-15037213 TTTCCCTGCTGCTGGGCATGGGG - Intronic
902447122 1:16474465-16474487 TCTCCCAGCAGCTGAGCTGGCGG - Intergenic
902534384 1:17110917-17110939 GTTTGCTGCAGGAGGGCTGGAGG + Intronic
902826014 1:18974804-18974826 TGTCCTCGCAGCTGGGCTGGGGG + Intergenic
903210266 1:21814387-21814409 TTCCGCTGCAGCCGACCTGGCGG + Exonic
903258199 1:22116724-22116746 GTTTGCTGCAGCGGGGGTGGGGG + Intergenic
904586026 1:31581110-31581132 TTTAGCTGGAGCTGGGGTAGGGG + Intronic
905505599 1:38476617-38476639 TTTCGCTGCGGCTGCGGCGGTGG - Intergenic
905941397 1:41866270-41866292 TGTCCCTGAAGCTGGGGTGGAGG - Intronic
906205834 1:43985829-43985851 TTGGGCTGAGGCTGGGCTGGGGG - Intronic
907303230 1:53500988-53501010 TCTAGCTGCAGATGGGCAGGGGG + Intergenic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
911247269 1:95532510-95532532 TTACACTGCAACTGGGATGGAGG - Intergenic
912021857 1:105115696-105115718 GTTTGCTGCTGCTGGGCGGGTGG - Intergenic
914703163 1:150151184-150151206 TTTCTCTGCAGATGAGATGGGGG - Intronic
914716024 1:150255981-150256003 TTTCACTGCTGCTGGGCTTTGGG - Intergenic
916161048 1:161915167-161915189 TGTAGATGCAGCTGGGCCGGTGG - Intronic
919421660 1:197376911-197376933 CTTCACTGTAGCTAGGCTGGGGG + Intronic
920132239 1:203741260-203741282 TGTGGCTGAAGCGGGGCTGGAGG - Exonic
921338045 1:214107882-214107904 TCTCCCAGGAGCTGGGCTGGGGG - Intergenic
922807408 1:228397541-228397563 TTGGGCTCCAGCTGGGGTGGAGG - Intronic
923114643 1:230923657-230923679 TCTTTCTGCAGCTGGGCTAGAGG + Intronic
1062824341 10:557258-557280 TGTAGGTTCAGCTGGGCTGGAGG - Intronic
1064262285 10:13795729-13795751 TTTCGGAGCTGCTGGACTGGGGG + Intronic
1065161452 10:22927182-22927204 TTTGGCTGGAGCTTGGATGGTGG + Intergenic
1065857081 10:29839446-29839468 TGCCCCTGCAGCAGGGCTGGGGG + Intergenic
1067280048 10:44864416-44864438 TACCCCTGCAGCTGGGGTGGGGG - Intergenic
1067805041 10:49386450-49386472 TTTGGGTTCGGCTGGGCTGGTGG - Intronic
1069721674 10:70553790-70553812 TTTCCCTGCAGCAGGGCTCAAGG - Intronic
1072444720 10:95489092-95489114 TTTGGCTGGACTTGGGCTGGGGG - Intronic
1076006729 10:126953699-126953721 TTTCCCTGGAGCTGTGTTGGTGG + Intronic
1076409576 10:130236335-130236357 TTTGTCTGCATCTGGGGTGGTGG + Intergenic
1076715040 10:132359440-132359462 GCTCCCTGCAGCTGGGCAGGAGG + Intronic
1077059303 11:610724-610746 TTTCTCCGCAGCTAGCCTGGGGG - Exonic
1077072226 11:680575-680597 TTTCTCTGTGGCCGGGCTGGAGG - Intronic
1077098819 11:812063-812085 GTTGGCTTCAGCTGAGCTGGTGG + Intronic
1077371826 11:2185930-2185952 TTCAGCTGGAGCTGGGGTGGGGG + Intergenic
1078331616 11:10426928-10426950 GGTCGCAGCAGCTGAGCTGGAGG - Intronic
1078930658 11:15910051-15910073 TTTGGCTGCACCTGTGCTTGTGG + Intergenic
1080268405 11:30424957-30424979 TTTGGAGGCAGCTGGGCTGGTGG - Intronic
1080385505 11:31808690-31808712 TTTCGAAGCAGCTGGGAAGGTGG + Intronic
1080642266 11:34164865-34164887 TTTCGCCTCAGCTGCCCTGGCGG - Intronic
1080859718 11:36142721-36142743 CCTGGCTGCAGCTGGGTTGGGGG - Intronic
1080886849 11:36376001-36376023 TTGCGGGGCAGCTGGGCCGGGGG + Exonic
1081277825 11:41171890-41171912 TTTCCCAGCAGCTGGCCTGGTGG - Intronic
1083654693 11:64223896-64223918 TTTCTCTGGAGCTGTGCTTGGGG + Exonic
1083753684 11:64778022-64778044 TTACGCGGCGGCTGGGGTGGCGG + Exonic
1083891074 11:65595970-65595992 TTTCACAGCAGCTGGGATGGTGG + Exonic
1083986749 11:66220620-66220642 TTTCCCTGCAGGTGGGCTTTGGG + Exonic
1088838130 11:113596831-113596853 TTTCCCTGGAGATGGGGTGGGGG + Intergenic
1089150382 11:116359284-116359306 TTTCTCAGCAGCAGGTCTGGTGG - Intergenic
1089465218 11:118680573-118680595 GTTCTCTGCAGCTAGGCTGAGGG - Intergenic
1089923218 11:122230115-122230137 GTTCACTGCAGCAGGGCGGGTGG + Intergenic
1090140476 11:124253717-124253739 TTTATCTGCAGCTGGGCGTGTGG - Intergenic
1090548342 11:127790797-127790819 TTTCCCGGGAGCAGGGCTGGAGG + Intergenic
1091454002 12:591726-591748 TTATCGTGCAGCTGGGCTGGGGG + Intronic
1091820455 12:3471827-3471849 ATCAGCTGCAGCTGGGATGGTGG + Intronic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096518872 12:52173100-52173122 TCTCGCTGCGGCTGCTCTGGAGG + Exonic
1099262502 12:80400693-80400715 TCTTGCTGCAGCTGCTCTGGCGG - Intergenic
1102975928 12:117207291-117207313 TATGGATGCAGCTGTGCTGGAGG + Intergenic
1103347334 12:120259974-120259996 TTCGGGTGCAGCGGGGCTGGGGG + Intronic
1104946687 12:132417767-132417789 TTCAGCTCCAGCTGGGCAGGAGG - Intergenic
1105206670 13:18231419-18231441 TTTTGTTTCAGTTGGGCTGGTGG - Intergenic
1106878789 13:34106427-34106449 TTTCCCTGCAGATGGGTTTGTGG + Intergenic
1112368593 13:98775513-98775535 GTTCGCGGCTGCTGGGCTGCAGG + Intergenic
1113880043 13:113619890-113619912 TTTACCTGCAGCTGGTGTGGGGG + Intronic
1115833078 14:37363852-37363874 TGAGGCTGCAGCTTGGCTGGGGG - Intronic
1116905207 14:50396993-50397015 TTTCCCTGCAGCCGGGAGGGCGG - Intronic
1117184621 14:53227401-53227423 TTTCCCTGCAGCTGGGGTTGTGG + Intergenic
1120011962 14:79426224-79426246 TAGCGCTGCAGCTGGCCAGGAGG - Intronic
1120136821 14:80879169-80879191 TTTAGCTGCAGATGGGCCTGAGG - Intronic
1121522229 14:94593982-94594004 TTTCTCTGCAGTTGTGCTGTGGG + Intronic
1124619683 15:31266568-31266590 TGTCGCTGCAGCTGGGCCTGAGG + Intergenic
1128355352 15:66922708-66922730 GATCCCTCCAGCTGGGCTGGAGG + Intergenic
1129941543 15:79501364-79501386 GTTCGAGGCAGCTGGGCAGGAGG - Intergenic
1132198678 15:99932877-99932899 TTTCACTGAAGCTCTGCTGGGGG + Intergenic
1132760539 16:1506705-1506727 TTGTGCTGCAGCAGGGGTGGGGG + Intronic
1134441937 16:14303577-14303599 TTTAGCTGGAGATGGGGTGGGGG + Intergenic
1137772366 16:51026798-51026820 TTTCACTGCAGCAGGGCTGTTGG - Intergenic
1138579588 16:57932077-57932099 TTTCGTGGCTCCTGGGCTGGTGG - Intronic
1140218853 16:73029064-73029086 CTTCTCTGCTGCTGGGCTTGAGG - Intronic
1141745061 16:85920032-85920054 TCCCGCAGCAGCAGGGCTGGGGG - Intronic
1144584454 17:16479680-16479702 TTTCGCTACAGCTCTGCTGCTGG - Intronic
1146583392 17:34059817-34059839 TTTTGCTGCAGCTGCTGTGGGGG - Intronic
1149363387 17:55916577-55916599 TTTTGCTGCAGCTTGGGTGTGGG + Intergenic
1152575667 17:81139779-81139801 CTCCTCTGCAACTGGGCTGGAGG + Intronic
1152744218 17:82031710-82031732 TTTCTCCGCAGCTCGGCTCGCGG + Exonic
1153716724 18:7857403-7857425 TTTCGATACAGCTGGGATGCTGG + Intronic
1159481440 18:68995480-68995502 TTTAGCTACAGCTGGGATGCTGG - Intronic
1160622006 18:80178340-80178362 GTCCGCTGCTGCTGGGCTGAGGG + Intronic
1160905596 19:1450313-1450335 CTTACGTGCAGCTGGGCTGGCGG - Intronic
1163508294 19:17720763-17720785 TCTCGCTGCAGCTGAGCCAGGGG - Intronic
1163635483 19:18435276-18435298 TCTCGATGCAGCTGCGCTGGCGG + Exonic
1164150131 19:22543247-22543269 TTTTTTTTCAGCTGGGCTGGTGG + Intergenic
1165433862 19:35786561-35786583 GTCCTCAGCAGCTGGGCTGGGGG + Intronic
1165772160 19:38386150-38386172 TTCCGCTTCAACGGGGCTGGCGG - Exonic
1166092776 19:40520955-40520977 TTGCTCTGTAGCTAGGCTGGAGG + Intronic
1166312917 19:41973165-41973187 TGCCGCTGCAGGTGGGATGGAGG + Intronic
1166317316 19:41996418-41996440 TTGCTCTCCAGCTGGGCCGGGGG + Intronic
1167904648 19:52648980-52649002 TGTCGCTGGAGCTGGGCAAGAGG - Intronic
925203523 2:1988114-1988136 TGTAGGTGCAGCTGGGCTGGCGG - Intronic
925203537 2:1988167-1988189 TGTAGGTGCAGCTGGGCTGGCGG - Intronic
925361866 2:3285383-3285405 GCTCGCTGCAGCTGGGCAGGCGG - Intronic
928085759 2:28345315-28345337 TTTCGCTGAAGCGGGGCTCCAGG - Intergenic
928469820 2:31563082-31563104 TGTAGCTGCAGCTGGGAAGGTGG - Intronic
929802288 2:45114428-45114450 TATTGCTGCAGCTGCTCTGGCGG - Intergenic
932501709 2:72188034-72188056 GGTGGCTGCAGCTGTGCTGGGGG + Intronic
933695321 2:85213135-85213157 TTTCCCTGTGGCTGGGGTGGGGG + Intronic
943231951 2:185264964-185264986 TTTAGCTTCAGCTGGGATGCAGG + Intergenic
947749143 2:232523782-232523804 GCTCCCTGCAGCTGGGCTCGCGG - Exonic
947835140 2:233169877-233169899 TTCTGCTGCAGCAGGGCTGGAGG + Intronic
948199493 2:236119582-236119604 CTTGGCTGGAGCTGGGCCGGGGG - Intronic
948502319 2:238404762-238404784 CTTGGCTGTAGCTGGGTTGGGGG + Intergenic
948579930 2:238979876-238979898 TTTCTCTGCACGTGGGGTGGTGG + Intergenic
948766402 2:240223760-240223782 TTTCGCACCAGAGGGGCTGGCGG - Intergenic
1168889941 20:1288458-1288480 TTGCACAGCAGCTGGGCTGCTGG + Intronic
1170697717 20:18674812-18674834 TTTGCCTGCAGTTGTGCTGGTGG + Intronic
1171072927 20:22092671-22092693 TTTCACTGTAGCTGGTCTGCTGG + Intergenic
1175178274 20:57126914-57126936 TTTCTCTGTAGCTGTGCGGGAGG + Intergenic
1175988138 20:62774507-62774529 TTCGGGCGCAGCTGGGCTGGCGG + Intergenic
1179596686 21:42447389-42447411 GCTCCCCGCAGCTGGGCTGGTGG - Exonic
1179884935 21:44309844-44309866 TTCCCCACCAGCTGGGCTGGGGG - Intronic
1179926535 21:44538157-44538179 GGTCTCTGCAGCTGGCCTGGAGG + Intronic
1180025245 21:45157087-45157109 TTTCACTGCATCTGTGCTGATGG + Intronic
1180759273 22:18187285-18187307 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
1180769582 22:18371581-18371603 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
1180776746 22:18491085-18491107 TTTTGTTTCAGTTGGGCTGGTGG - Intergenic
1180809474 22:18748451-18748473 TTTTGTTTCAGTTGGGCTGGTGG - Intergenic
1180827521 22:18874544-18874566 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
1181072395 22:20353437-20353459 TTTTGTTTCAGTTGGGCTGGTGG - Intronic
1181195466 22:21182371-21182393 TTTTGTTTCAGTTGGGCTGGTGG - Intergenic
1181213981 22:21310403-21310425 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
1181524431 22:23472036-23472058 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
1181788302 22:25243499-25243521 TGTCTCTGGTGCTGGGCTGGCGG + Intergenic
1181820043 22:25468513-25468535 TGTCTCTGGTGCTGGGCTGGAGG + Intergenic
1182684017 22:32106833-32106855 TTTACCTGGTGCTGGGCTGGAGG + Intronic
1183934134 22:41252540-41252562 TCTCGAAGCAGCTGGGCTGACGG + Intronic
1203231412 22_KI270731v1_random:112768-112790 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
1203277618 22_KI270734v1_random:100534-100556 TTTTGTTTCAGTTGGGCTGGTGG + Intergenic
949711891 3:6880437-6880459 TTTCTCTGCAGATGTCCTGGCGG + Intronic
953456520 3:43046813-43046835 TTTTGGTGCAGCTGGGATGGAGG - Intronic
955010852 3:55012914-55012936 TTTTGGTCCAGCTGGGGTGGGGG - Intronic
956991201 3:74767814-74767836 TTTGGGAGCAGCTGGCCTGGTGG + Intergenic
959824065 3:110771829-110771851 TGTGGCTGCAGCAGAGCTGGTGG - Intergenic
960809343 3:121613234-121613256 TTTCAGTGGAGCTCGGCTGGAGG - Intronic
961481281 3:127182761-127182783 TGTAGCTGCAGCTGGGGTGAGGG - Intergenic
965390216 3:168095481-168095503 TTTGGCTGCAGCTGCCCGGGCGG - Exonic
966372887 3:179266824-179266846 AATGGCTGCAGCTGCGCTGGGGG - Intronic
970050119 4:11904983-11905005 TTTTGCTTCAGCTGGTCTGTGGG + Intergenic
970397337 4:15681880-15681902 GGTCGCTGCGGCTGGGCTGGAGG + Exonic
970473736 4:16401587-16401609 TTAGGCTGCAGCAGGGATGGAGG - Intergenic
971148856 4:24009660-24009682 TTTGGGTGCAGCTTGACTGGAGG + Intergenic
971308808 4:25506435-25506457 TCTCGATGCAGCTGAGCTGGCGG - Intergenic
975342546 4:73258407-73258429 TTTCGCTGCTGCTGGGGGGTCGG + Exonic
976704499 4:88007361-88007383 TTTCCCTGCAGGCGGGCTGGCGG + Intergenic
977471779 4:97452137-97452159 TACAGCTGCAGCTGTGCTGGGGG - Intronic
978028527 4:103909415-103909437 TTTCACTGTAGCTGTTCTGGTGG + Intergenic
979498427 4:121411334-121411356 TCTTGCTGCAGCTGCTCTGGAGG + Intergenic
980237140 4:130122922-130122944 TTTTGCTGCTTCTGTGCTGGAGG + Intergenic
982000179 4:151015226-151015248 TCTCGCTGCTCCTGGGCGGGGGG - Intronic
982189939 4:152843584-152843606 TCTTGCTGCAGCTGCTCTGGGGG + Intronic
982657758 4:158170769-158170791 TCTCCCTGGAGCTGGGCTGCAGG + Exonic
982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG + Intergenic
983260239 4:165448438-165448460 TTTCTCAGCAGATGGGCTAGGGG - Intronic
984919131 4:184748551-184748573 TGTCCCTGCAGCTGGGCTCTGGG + Intergenic
985103704 4:186482201-186482223 TTCCACTGCAGCTGGGCAGGAGG - Intronic
985685053 5:1277586-1277608 TTCCGCTGCAGCGGGGATGTGGG + Intronic
985961748 5:3307779-3307801 TCTTGCTGTTGCTGGGCTGGTGG + Intergenic
991169492 5:63604356-63604378 TGAAGCTGCTGCTGGGCTGGGGG + Intergenic
994730229 5:103482875-103482897 TTTTGCTGCTGCTGTGGTGGTGG - Intergenic
997586311 5:135045675-135045697 TTACCCTGAAGCTGGGATGGGGG + Intronic
998051360 5:139038757-139038779 TTTCACTGCTGCTGGCCTGAGGG + Intronic
1000511617 5:162190182-162190204 TTTCGCTGCAGCTGCTGTGGGGG + Intergenic
1000878326 5:166667903-166667925 TTTCTCTGTAGTTGTGCTGGTGG + Intergenic
1001920578 5:175596557-175596579 TGCTGCTGCAGCTGGTCTGGGGG + Intergenic
1008580872 6:52905747-52905769 CTTGGCTGCAGCTGGAGTGGAGG - Exonic
1009876444 6:69511542-69511564 TTTAGCCCCAGCTGGGATGGAGG - Intergenic
1012211376 6:96522158-96522180 TTTCGCTGCAGCTGGGCTGGGGG - Intronic
1012987764 6:105893183-105893205 TGTCTCTGCAGATGGGCTGGAGG + Intergenic
1013072524 6:106741851-106741873 TCTGGCAGCTGCTGGGCTGGTGG - Intergenic
1019213598 6:170425182-170425204 TTTGGGAGCATCTGGGCTGGGGG - Intergenic
1020869284 7:13607544-13607566 TTTAGCCGCAGCTGGGATGTAGG - Intergenic
1022123064 7:27328841-27328863 TTTGGTAGCAGCTGTGCTGGTGG - Intergenic
1022440335 7:30427805-30427827 TTTCTCTGTAGCTGGTCAGGCGG - Intronic
1022694762 7:32693258-32693280 GTTCCCTGCAGCTGGGCAGCAGG + Intergenic
1024203676 7:47133112-47133134 TTCTGCTGCAGCTGTGTTGGAGG - Intergenic
1026534357 7:71227933-71227955 TTTCTCTGCTTCTGTGCTGGTGG + Intronic
1030477531 7:110055540-110055562 TTTCTCTGCAGCGGGGCTTGAGG - Intergenic
1035989794 8:4477024-4477046 TTTCCCTCCCGCAGGGCTGGTGG + Intronic
1038746241 8:30257743-30257765 TTTCACTGCAGCTGGGAGTGAGG - Intergenic
1038882970 8:31635196-31635218 TTTCAGTCCAGCTGGGATGGAGG - Intergenic
1041034740 8:53776476-53776498 TTTAGATGTAGCTGGGCTGCTGG - Intronic
1042088599 8:65133938-65133960 TCTCGCTGCAGCTGCTGTGGGGG - Intergenic
1044409223 8:91866884-91866906 TCTCGCTGCAGCTGGTGTGATGG - Intergenic
1045320308 8:101077317-101077339 TTTCTCTGACCCTGGGCTGGAGG + Intergenic
1047208654 8:122822855-122822877 TTCTGCTGGAGCTGGGCAGGTGG + Intronic
1048781507 8:138007095-138007117 TTTAGCCGCAGCTGGGATGCAGG - Intergenic
1049252411 8:141596368-141596390 CTTCCCTGCAGCTGATCTGGGGG + Intergenic
1049527177 8:143133286-143133308 TGCGGCTGCAGCTGGACTGGAGG - Intergenic
1049800720 8:144516344-144516366 CTCCACTGCTGCTGGGCTGGGGG + Exonic
1053892714 9:42710810-42710832 GGTCGCTGCTGCTGGGGTGGGGG + Intergenic
1056678381 9:88696210-88696232 CTTCTCTGTAGCTGGGCTGGTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057879808 9:98784615-98784637 TTTGGCTGGAGTGGGGCTGGAGG + Intronic
1059179075 9:112194976-112194998 TTATCCTGCAGCTGGGCTGGAGG - Intergenic
1059349578 9:113654966-113654988 TGTAGCAGCAGCTGGGCCGGAGG - Intergenic
1059434571 9:114268195-114268217 TTCCACTGGAGCAGGGCTGGGGG + Intronic
1059434596 9:114268329-114268351 TTCCACTGGAGCAGGGCTGGGGG + Intronic
1060961090 9:127681258-127681280 TTTGGCTTCAGCTGGGCCAGAGG + Intronic
1061417627 9:130455771-130455793 TGACCCTGCAGGTGGGCTGGTGG - Intronic
1061625662 9:131839284-131839306 CTCAGCTGCAGCTGGGGTGGCGG - Intergenic
1062502096 9:136856027-136856049 TGTCTCTGCAGCGGGCCTGGGGG + Exonic
1062617239 9:137403414-137403436 TGCTGCTGCTGCTGGGCTGGGGG - Intronic
1185602859 X:1352159-1352181 TTGAGCTGCAGCTGGGCGGTAGG + Exonic
1190008053 X:46758934-46758956 TGCCGCTGCTGCTGGGTTGGGGG - Exonic
1190056010 X:47181417-47181439 TCTCTCTGCAGCTGTGGTGGGGG + Intronic
1190702142 X:52997054-52997076 TTTGGCTGCAGAGGGGCTGGAGG - Intergenic
1191067622 X:56367156-56367178 TCTCGCTGCAGCTGCTGTGGGGG + Intergenic
1191117000 X:56863090-56863112 TTTCTCTGCAAGAGGGCTGGTGG - Intergenic
1195075871 X:101326699-101326721 TTTTGCTGCAGCTGCTGTGGGGG - Intergenic
1195145987 X:102018043-102018065 TTCAGCTTCAGCTGGGATGGTGG - Intergenic
1196046216 X:111259014-111259036 GTTGGCTGCAGCAGGGGTGGGGG + Intronic
1200103716 X:153701110-153701132 TTTGGGTGCAGCTGGGGAGGGGG - Intronic
1200237086 X:154472895-154472917 TATTGCTGCTGCTGGGGTGGGGG - Exonic