ID: 1012217806

View in Genome Browser
Species Human (GRCh38)
Location 6:96609814-96609836
Sequence TGCCATGGCCATAGTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012217806_1012217810 25 Left 1012217806 6:96609814-96609836 CCTAGCTCACTATGGCCATGGCA 0: 1
1: 0
2: 0
3: 22
4: 135
Right 1012217810 6:96609862-96609884 CTAGTTGCTCATCTGAAAAGAGG No data
1012217806_1012217811 26 Left 1012217806 6:96609814-96609836 CCTAGCTCACTATGGCCATGGCA 0: 1
1: 0
2: 0
3: 22
4: 135
Right 1012217811 6:96609863-96609885 TAGTTGCTCATCTGAAAAGAGGG 0: 1
1: 0
2: 3
3: 51
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012217806 Original CRISPR TGCCATGGCCATAGTGAGCT AGG (reversed) Intronic
901435597 1:9245582-9245604 TGCCAGGGCTAGGGTGAGCTGGG + Intronic
901646581 1:10720065-10720087 TGGCCTGGCCACAGAGAGCTTGG + Intronic
901843751 1:11969540-11969562 TTCCAGGGCCAGAGTCAGCTGGG - Intronic
902622751 1:17659978-17660000 TGCCATGGCCACATTGCTCTTGG - Intronic
903809331 1:26026168-26026190 TGTCAAGGCTAGAGTGAGCTGGG + Intronic
906995272 1:50786743-50786765 TGGCATAGGCATAGTGAACTAGG + Intronic
910001939 1:82351832-82351854 TCCCCTTGCCATAGTGAGTTTGG - Intergenic
918977377 1:191507176-191507198 TGCCATGCCATTAGTGAGCAGGG - Intergenic
923972688 1:239222947-239222969 TCCCTTTGACATAGTGAGCTTGG - Intergenic
924218346 1:241848260-241848282 TGCTCTGGCCACAGTGAGTTAGG + Exonic
1062878919 10:962843-962865 TGCCGTAGCCTCAGTGAGCTCGG + Intergenic
1064360251 10:14657877-14657899 TGCCAAGGCTGCAGTGAGCTGGG - Intronic
1068505743 10:57897467-57897489 AGCCATGGCCACATAGAGCTTGG + Intergenic
1069045685 10:63741023-63741045 TGTCATGGCAATAGTGAGTTCGG - Intergenic
1069669369 10:70188880-70188902 TGCCATGGGGATAGTGTGCAGGG - Intergenic
1075223221 10:120602206-120602228 TACGGTGGCCACAGTGAGCTGGG - Intergenic
1076030543 10:127154016-127154038 TTCCATGACCATGATGAGCTTGG - Intronic
1076246308 10:128950152-128950174 TCCCATGGCCCTAAGGAGCTTGG - Intergenic
1078050839 11:7963484-7963506 GGCCATGGCCATGGTGATCTGGG + Exonic
1079891898 11:26066559-26066581 TCCTTTGGGCATAGTGAGCTTGG - Intergenic
1080311993 11:30905451-30905473 TGCCATGGCCAGAGAGAGCCTGG + Intronic
1084757212 11:71247540-71247562 TGCCATGGCCCTGCTGGGCTGGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1089001159 11:115053595-115053617 TGTGATGGCCCTAGTGAGCTTGG - Intergenic
1090806116 11:130203366-130203388 TGCCCAGGCTACAGTGAGCTAGG - Intronic
1093655914 12:21694301-21694323 TGCCATGGTCATAGTGAAACTGG + Intronic
1094067730 12:26379108-26379130 TGCCATGCCCATAATGTGCCAGG - Intronic
1094618623 12:32059061-32059083 TGCCATGGCCAGAGTCAGATTGG - Intergenic
1096653539 12:53074449-53074471 TCCCATGGCCAGAGGAAGCTGGG - Intronic
1099646546 12:85365242-85365264 TGCAATAGCCATAGTAACCTAGG - Intergenic
1101073385 12:101100144-101100166 TACCAAGTACATAGTGAGCTAGG - Intronic
1105984423 13:25551421-25551443 GGTCATGGCCTTGGTGAGCTCGG + Exonic
1109787774 13:67203526-67203548 TACCATTGCCTAAGTGAGCTGGG + Intronic
1112336341 13:98520314-98520336 TGCCATTGGCATTTTGAGCTGGG - Intronic
1113728726 13:112624712-112624734 CGCTGTGGCCATAGTGGGCTTGG + Intergenic
1113922332 13:113920093-113920115 TGCCATGCCCTGAGTGTGCTGGG + Intergenic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1121920544 14:97876806-97876828 TGCCTTGCCAATAATGAGCTGGG + Intergenic
1122297358 14:100712994-100713016 TGGCATGGCCGTGGTGAGCTGGG - Intergenic
1125430775 15:39591214-39591236 TGTCATAGTCATACTGAGCTGGG - Exonic
1127089948 15:55457216-55457238 TGGCATGGCCAGAGTGAGACTGG + Intronic
1127377855 15:58401671-58401693 TCCCATGGCCACTGTGAGCAGGG - Intronic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1128380559 15:67108684-67108706 TGACATGCCCTTAGTGACCTGGG - Intronic
1131174083 15:90199294-90199316 TGCCTGGGCCCTAGGGAGCTGGG + Intronic
1138266751 16:55665081-55665103 TGACATGGCTAGATTGAGCTGGG + Intronic
1140917300 16:79505787-79505809 GGCCATGGGGATAGGGAGCTGGG + Intergenic
1149406460 17:56356848-56356870 TGCCATGGCCATCCTGCACTGGG + Intronic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1150244109 17:63660977-63660999 GGCCTTGGCCAAAGTGAGGTGGG - Intronic
1150557497 17:66267736-66267758 TGACATGGCCATAGACAGCTGGG - Intergenic
1151132334 17:71910131-71910153 GGCCCTGGCCTTAGTAAGCTTGG - Intergenic
1153606782 18:6842009-6842031 AGCCATGGCCAAAATAAGCTTGG - Intronic
1153771916 18:8423443-8423465 TGCTGTGGCCATGGTGAGCTGGG - Intergenic
1154168490 18:12033966-12033988 TCCCTTGGGCATAGTGAGTTTGG + Intergenic
1155318122 18:24592445-24592467 TTCCATGGCCAAGCTGAGCTTGG + Intergenic
1160811747 19:1015823-1015845 TTCCACGCCCACAGTGAGCTGGG + Intronic
1163689503 19:18730878-18730900 TCCCATGTCCAGAGGGAGCTTGG + Intronic
1165377708 19:35454793-35454815 TGCCATGGCCACAGTAAACATGG + Intergenic
1166760390 19:45220751-45220773 AGCCATGGCCAGTTTGAGCTGGG + Intronic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
927467152 2:23345894-23345916 AGCCATGCCCAAAGTGAGCGGGG + Intergenic
930680217 2:54249690-54249712 TGCCATGGCCTCAGAGTGCTGGG - Intronic
936663122 2:114564380-114564402 TGCTATGGTCTTAGTGAGCTTGG - Intronic
940517016 2:154696185-154696207 TGCCAAGGGCATAATGAGCTTGG + Intergenic
940714178 2:157200447-157200469 TGCCATAGCCAAAGTCATCTAGG - Intergenic
942458833 2:176155869-176155891 TGCGATGGACAAAGTGAGATGGG - Intronic
942636450 2:178011854-178011876 TGCCATGGCCTCAGTAACCTTGG - Intronic
942715246 2:178884272-178884294 TCCCTTGGTCATAGTGAGTTTGG - Intronic
1170312738 20:15010430-15010452 TACCACGGCTATAGTGATCTTGG - Intronic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1172020096 20:31908051-31908073 TGCCATGTCCTCAGTGAGCAAGG + Intronic
1173190807 20:40874362-40874384 TGCCAGGGCCATAGTTATCTGGG - Intergenic
1175340562 20:58226758-58226780 TGGTATGGTCATGGTGAGCTCGG + Intronic
1180888407 22:19265939-19265961 TGTCAAGGCTACAGTGAGCTGGG - Intronic
1183315743 22:37136021-37136043 TGCCATGGGCCTTGTGAGTTGGG - Intronic
1183722479 22:39570736-39570758 AGCCATGTCCACACTGAGCTGGG - Exonic
1184805612 22:46793209-46793231 GGCACTGGCCAGAGTGAGCTGGG + Intronic
949463945 3:4324795-4324817 TGCCTTTGGCATAGTGAGTTTGG + Intronic
950031252 3:9855337-9855359 TCCCATGGCCACTATGAGCTGGG - Intergenic
950054355 3:10012716-10012738 TCCCATGGCCACCATGAGCTGGG - Intergenic
950305542 3:11913163-11913185 TCCCATGGCCACCATGAGCTGGG - Intergenic
950414883 3:12863445-12863467 TCCCATGGCCACAATGAGCTGGG - Intronic
950459647 3:13113558-13113580 TGCCCTGGGCATAGGGAGGTGGG + Intergenic
951039229 3:17969812-17969834 GGCCATTGCCATAGGGAGCTTGG + Intronic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
956823234 3:72972866-72972888 GGCCAAGGCTACAGTGAGCTAGG + Intronic
957625470 3:82648499-82648521 TGGCATGGGCATGGAGAGCTAGG - Intergenic
959082130 3:101813163-101813185 TGCCATGAGCATAGGAAGCTTGG - Intronic
960021273 3:112956718-112956740 TCCAATGGCCACAGTGATCTGGG - Intronic
961450643 3:127000896-127000918 TGGCATGGCCAGTGTGAGCGGGG - Intronic
965007091 3:163041171-163041193 TTACATGGCCAGAGTTAGCTGGG + Intergenic
967154199 3:186677574-186677596 GGCCATGGCAACAGTGACCTTGG - Exonic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
968695385 4:2022973-2022995 TACAATGGCCATACTGGGCTGGG + Intronic
971589938 4:28454434-28454456 TGGCATGGATATAGTGAGCAGGG - Intergenic
972577411 4:40364574-40364596 TACCAAGTCCATGGTGAGCTTGG - Intergenic
973006289 4:45010728-45010750 TTCCTTTGTCATAGTGAGCTTGG - Intergenic
974434089 4:61834635-61834657 TGACAGGGCCATAGTGAGAATGG + Intronic
974979955 4:68943338-68943360 TGCCATGGCTTAAGAGAGCTTGG + Intronic
975452656 4:74547648-74547670 TGCCAGGGCCATTATGAGCCTGG + Intergenic
976334644 4:83871312-83871334 TTCCTTGGCCATAGTGACCTTGG + Intergenic
976829097 4:89293453-89293475 TGCCATGGACAAGGTGATCTGGG - Intronic
977576663 4:98682024-98682046 ATTCAAGGCCATAGTGAGCTGGG + Intergenic
978669076 4:111224257-111224279 TGCCTTGTCCATAGTGACCTTGG - Intergenic
978828372 4:113052375-113052397 CACCCAGGCCATAGTGAGCTTGG - Intronic
980575041 4:134676062-134676084 TCCCATTGGCATAGTGAGTTTGG + Intergenic
985488891 5:167565-167587 TCCCAGGGCCATGGTGAGCCGGG - Intronic
985756257 5:1720384-1720406 TGCCAAGGCCATTCTGAGCATGG + Intergenic
985871478 5:2560885-2560907 GGCCATTGCCATAGTGAGGGCGG + Intergenic
987298247 5:16573587-16573609 TGCCTTGGACTTTGTGAGCTTGG - Intronic
989778444 5:45236390-45236412 TGAAATGACCATAGGGAGCTAGG - Intergenic
990300107 5:54441468-54441490 TGCCAGGGCCATAGTGCTATTGG + Intergenic
991997037 5:72398201-72398223 TGCCTTTGGCATAGTGAACTGGG + Intergenic
992202504 5:74398279-74398301 AGCCATGGCCACACAGAGCTGGG + Intergenic
993652424 5:90537963-90537985 TGCCTTGGGCATAGTGAGTTTGG + Intronic
1001667063 5:173442007-173442029 TGCCATGGCCTCAGGGAGCATGG - Intergenic
1002469687 5:179427994-179428016 TGCGATGGCGATACTGACCTCGG - Intergenic
1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG + Intergenic
1006003537 6:30985298-30985320 AGCCTTGGCCATAGTGATCAAGG + Intronic
1006387765 6:33741123-33741145 TTCCCTGGCCATGGTGATCTTGG + Intronic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1014277824 6:119406278-119406300 TCCCTTTGGCATAGTGAGCTTGG - Intergenic
1014597869 6:123368076-123368098 TACAGTGGCCTTAGTGAGCTAGG - Intronic
1015690605 6:135917937-135917959 TGCCAGGGCCACAAAGAGCTGGG - Intronic
1016426482 6:143941513-143941535 TGCCATGGGCACTGTGAGCCTGG - Exonic
1016858442 6:148695037-148695059 TGGCAGGGCCCTAGTGTGCTGGG + Intergenic
1018300463 6:162396993-162397015 TCCCATGGCCATAGTGGTGTTGG + Intronic
1020446207 7:8270803-8270825 GGTCAAGGCTATAGTGAGCTGGG + Intergenic
1021138383 7:16993396-16993418 AGCTATGGACATAGTGAACTAGG - Intergenic
1023806532 7:43876783-43876805 TCCCATGGCCGCAGTGAGCTTGG - Exonic
1026143948 7:67729481-67729503 TCCCTTTGGCATAGTGAGCTTGG + Intergenic
1030760618 7:113345978-113346000 TACCAGGGCAACAGTGAGCTGGG + Intergenic
1032702934 7:134397906-134397928 TGCCATGGCCTCAGGGAGATGGG + Intergenic
1033527299 7:142228893-142228915 TGCCATGGCAATGGTAAACTGGG + Intergenic
1034148532 7:148894031-148894053 TCCCAAGGCCAGAGTGAGCTGGG + Intergenic
1035591756 8:821484-821506 TGCCATGGAAAAAATGAGCTGGG + Intergenic
1035877127 8:3203251-3203273 GGCCATGTCCAGAATGAGCTGGG - Intronic
1038020086 8:23545360-23545382 TGCCAGGGGCACAGTCAGCTGGG + Intronic
1040959189 8:53013019-53013041 TGACATGGCCAGGGTGAGCAAGG + Intergenic
1041339610 8:56830125-56830147 TGCCATAGCCAAAGTCATCTAGG - Intergenic
1049650145 8:143762568-143762590 TGTCATGTCCACAGGGAGCTTGG - Intergenic
1049725590 8:144144247-144144269 TGCCATGGCCACACTCAGCTGGG + Intergenic
1053268856 9:36736205-36736227 TGCCTTGGCAAAAGAGAGCTGGG + Intergenic
1053382621 9:37661158-37661180 TGACATGGCCAGACTGACCTGGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1059246066 9:112850709-112850731 TGCCATGGCCAGACTGTCCTAGG + Intronic
1059290794 9:113221840-113221862 TGGCATAGCCAGAGTGACCTTGG + Intronic
1060970434 9:127734670-127734692 TGCCATGTGCATAGGCAGCTTGG - Intronic
1062333803 9:136056160-136056182 TGCCAGGGCCTCAGGGAGCTGGG + Intronic
1189494142 X:41493934-41493956 TGCCAGGGTCATAGTGAGTGCGG - Intergenic
1192227907 X:69241972-69241994 ATCCAGGGCCTTAGTGAGCTGGG + Intergenic
1193480364 X:82019876-82019898 AGCCATGGCCATAGCCAGTTTGG - Intergenic
1195561065 X:106284502-106284524 TGCCAGGGCCAAAGGAAGCTGGG + Intergenic
1197004067 X:121474609-121474631 CGCCATGGCCTTGCTGAGCTGGG + Intergenic
1199794293 X:151179844-151179866 TGCCATGTCCATTGGGGGCTGGG + Exonic