ID: 1012221435

View in Genome Browser
Species Human (GRCh38)
Location 6:96653631-96653653
Sequence GGTTCCAAATATGCATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012221435_1012221438 8 Left 1012221435 6:96653631-96653653 CCAGGAGATGCATATTTGGAACC 0: 1
1: 0
2: 2
3: 16
4: 102
Right 1012221438 6:96653662-96653684 TAAGACATCAGTGGAGACATTGG 0: 1
1: 0
2: 1
3: 23
4: 186
1012221435_1012221437 -1 Left 1012221435 6:96653631-96653653 CCAGGAGATGCATATTTGGAACC 0: 1
1: 0
2: 2
3: 16
4: 102
Right 1012221437 6:96653653-96653675 CAGCTTATGTAAGACATCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012221435 Original CRISPR GGTTCCAAATATGCATCTCC TGG (reversed) Intergenic
902764245 1:18604319-18604341 GGATGCAGATATGCATTTCCTGG - Intergenic
903382157 1:22904955-22904977 GCCTCCAAATTTGCAGCTCCCGG + Intronic
908368909 1:63459897-63459919 GGTCAGAAATATGCATTTCCAGG + Intronic
908443654 1:64180149-64180171 GGTTTCAAATGTGCAGCTCATGG + Exonic
910532090 1:88249081-88249103 GGGTCCAAATTTGCCTCACCAGG + Intergenic
910682285 1:89879280-89879302 GGTTCCAATTATCAATTTCCTGG + Intronic
922028947 1:221779919-221779941 GGATCCTAATGTGCATCTCTGGG - Intergenic
922040956 1:221896702-221896724 GATTCCAAATATGCATCAACTGG + Intergenic
1065793371 10:29282318-29282340 GGTTCCAATTATGAATTTCGTGG - Intergenic
1066817526 10:39438830-39438852 TGCTCCAAATATGCAACTGCAGG + Intergenic
1071200134 10:83212637-83212659 GGTTCCATACATGCATCACATGG + Intergenic
1073593497 10:104778267-104778289 GGTTCCATACATGCATCTCCAGG + Intronic
1075100927 10:119505657-119505679 TGTTCCAAATGTGCCGCTCCAGG + Intronic
1076221132 10:128734011-128734033 GATTCCAAATCTGCATCCCCAGG + Intergenic
1079879683 11:25909895-25909917 GGTTTTATATATGCATATCCAGG + Intergenic
1082819406 11:57534303-57534325 GCTTCCATATATTCATCACCAGG + Intergenic
1083130406 11:60620115-60620137 AGTTCTAAATATGCAATTCCTGG + Intergenic
1085024975 11:73231089-73231111 GGCACCACATAAGCATCTCCCGG + Intronic
1092750411 12:11713895-11713917 GGTTGCACATAGGAATCTCCTGG - Intronic
1095035220 12:37357615-37357637 CGTTCCAAATATCCATTTGCAGG + Intergenic
1097684441 12:62678241-62678263 GGTTTCAAAAATGCAAATCCTGG - Intronic
1098504941 12:71238536-71238558 TGTCCCAAATATGCTTTTCCTGG + Intronic
1102939052 12:116922493-116922515 TGTTCCCAATGTACATCTCCAGG - Intronic
1107653831 13:42572205-42572227 GGTCCCATATATGAAGCTCCTGG + Intronic
1112117221 13:96369276-96369298 GGTTCCAAAGGAGTATCTCCCGG - Intronic
1113773032 13:112923973-112923995 TGGGCCAAAAATGCATCTCCTGG - Intronic
1116968340 14:51038496-51038518 TGCTCAGAATATGCATCTCCTGG + Intronic
1118665904 14:68069296-68069318 GGTTCCAGATATACATGTGCAGG + Intronic
1119309106 14:73631791-73631813 GGTTCCTGATATGCATGTCTAGG - Intergenic
1121433846 14:93906006-93906028 GGTCTCAAAAATGCATCTGCAGG + Intergenic
1123185445 14:106512147-106512169 ATTTCCAATTATGCATCTCAGGG - Intergenic
1126035961 15:44545991-44546013 GGTTTTAAATATGCATCTTCTGG + Intronic
1130820503 15:87490261-87490283 GTTTCCAAATATTAATCTCATGG + Intergenic
1135184198 16:20300675-20300697 GGTACCACACATGCAGCTCCGGG + Intergenic
1136087842 16:27898270-27898292 GGTTCCTACTACCCATCTCCAGG - Intronic
1136222703 16:28838493-28838515 AGTTCCAAATCTGCATATGCTGG - Intergenic
1139175078 16:64677500-64677522 TGATCCACATATGCATCCCCAGG - Intergenic
1141367856 16:83460549-83460571 TTTTCCACATATGCATGTCCTGG - Intronic
1143412825 17:6722248-6722270 GCTCCCAAATGTACATCTCCAGG + Intergenic
1144621260 17:16819976-16819998 GGCTCTCAATCTGCATCTCCAGG + Intergenic
1144625754 17:16843705-16843727 GGTTCTCAATGTGCATCTCCAGG + Intergenic
1144880678 17:18429015-18429037 GGTTCTCAATGTGCATCTCCGGG - Intergenic
1145151559 17:20515372-20515394 GGTTCTCAATGTGCATCTCCGGG + Intergenic
1146162908 17:30569630-30569652 GGTTCTCAATCTGCATCTCCAGG + Intergenic
1147486553 17:40820552-40820574 GGCTCTCAATTTGCATCTCCAGG + Exonic
1147573240 17:41584298-41584320 GGCTCTCAATCTGCATCTCCAGG + Exonic
1147579909 17:41622396-41622418 GGTTCTCAATCTGCATCTCCAGG + Exonic
1147581610 17:41630460-41630482 GGTTCTCAATCTGCATCTCCAGG + Intergenic
1148037738 17:44680775-44680797 GTTTCCAAAGATGAATCTCCTGG - Intronic
1151231414 17:72687919-72687941 GGTTCAAATTATGGCTCTCCAGG - Intronic
1152917303 17:83047356-83047378 GGTTCCAAATATGAATCTCGGGG + Intronic
1153681805 18:7508022-7508044 GGTTCCAGATATGGTCCTCCAGG + Intergenic
1155030619 18:21980615-21980637 GATGCCAAATTTGGATCTCCAGG + Intergenic
1155136756 18:23003175-23003197 GATTCCAAATCTGCATCTCTAGG + Intronic
1156226384 18:35113272-35113294 AGTTTCAAATAGGAATCTCCTGG + Intronic
1157955506 18:52093220-52093242 AGTTCCAATCATGCATCACCAGG - Intergenic
1158332415 18:56377059-56377081 GGTTCTAGATAAACATCTCCAGG + Intergenic
1160602522 18:80024728-80024750 GGTTCCTTATATGCACCTGCCGG - Intronic
1165196453 19:34107834-34107856 GGTTCCAAGTGTGAATCTTCTGG - Intergenic
1166404353 19:42508964-42508986 CCTTCCTAATAGGCATCTCCAGG - Exonic
925082364 2:1080374-1080396 GGTTCCAACTTTACAACTCCAGG + Intronic
926006331 2:9376016-9376038 GGGACCAAATGTGCATCTACAGG - Intronic
927468514 2:23354753-23354775 AGTCCCTAATTTGCATCTCCAGG - Intergenic
928575809 2:32653834-32653856 GGTCACAAATATTCATTTCCAGG + Intronic
932492034 2:72128390-72128412 GGTTCCCAGTGTGCAGCTCCAGG + Intergenic
932652995 2:73579996-73580018 GATTCCTAATATGCATCTGTTGG + Intronic
934896412 2:98123765-98123787 ACTTCCAAAGATGCATGTCCTGG - Intronic
937957605 2:127430437-127430459 GGCTGCACATTTGCATCTCCCGG + Intergenic
940885885 2:158988899-158988921 GCTTCCTAATAGGCATTTCCTGG + Intronic
944762176 2:202827554-202827576 GATTCCAAATATTCATCTAATGG + Intronic
946063645 2:216967845-216967867 GGCCCCTAATAAGCATCTCCAGG - Intergenic
947040173 2:225909792-225909814 GGATAGAAATATGCAACTCCAGG + Intergenic
1168834113 20:865757-865779 GGTCCCAAATGTGGTTCTCCTGG + Intergenic
1171911444 20:30962249-30962271 CGCTCCAAATATCCATCTGCAGG + Intergenic
1176001416 20:62833145-62833167 GGGTCAAAATCTGCAGCTCCCGG + Intronic
1179593926 21:42429759-42429781 GGATAGAAACATGCATCTCCTGG - Intronic
1180424390 22:15154720-15154742 GGTTCCAAATGTCCTTTTCCAGG + Intergenic
1183252247 22:36738272-36738294 TTGTCCAAATGTGCATCTCCAGG - Intergenic
1183772047 22:39935073-39935095 GGTTCCAACTCTTGATCTCCTGG - Intronic
954625833 3:52021446-52021468 GGTTCCAAAGGAGCCTCTCCCGG + Intergenic
957453223 3:80406649-80406671 GGTTCCAGATCTTCATCTCTAGG + Intergenic
964806184 3:160612068-160612090 GATTCCAAATATACTCCTCCTGG - Intergenic
969976931 4:11112783-11112805 GGTTCTAAATCTGCAGGTCCTGG - Intergenic
972071839 4:35030093-35030115 GGTTCCAAATACTGATTTCCTGG - Intergenic
981099817 4:140817589-140817611 TCTTCCAAATATCCTTCTCCTGG - Intergenic
981770575 4:148303610-148303632 GGGACCAAAAATGCATCTCGGGG - Intronic
984893196 4:184511859-184511881 GTTTCCAAATTTCCTTCTCCAGG - Intergenic
988425764 5:31062016-31062038 GCTTGCAAATATGCATGTCAAGG - Intergenic
990630868 5:57667658-57667680 AATTCCAAACATGCATCTTCTGG + Intergenic
995633944 5:114163681-114163703 TGTTCCTGATGTGCATCTCCTGG + Intergenic
997630908 5:135368427-135368449 GATTCCACAGATGCATTTCCAGG + Intronic
1002633162 5:180594237-180594259 GATTCCAAAAATACATCCCCTGG + Intergenic
1005271442 6:24168220-24168242 ACTTCCAAATCTGCATCTCCCGG - Intergenic
1006276775 6:33010465-33010487 GGTTCCAAATGAGAATCACCTGG + Intergenic
1007078899 6:39085063-39085085 GGTTCCAGCTAGGCCTCTCCAGG + Intronic
1007804861 6:44434852-44434874 GGTTCCACTGATTCATCTCCTGG + Intronic
1012221435 6:96653631-96653653 GGTTCCAAATATGCATCTCCTGG - Intergenic
1016479001 6:144461211-144461233 GTTTCCAGATATGCATGTCCAGG - Exonic
1018184793 6:161257173-161257195 TGTTCCAAATATCCATCACCCGG + Intronic
1018221402 6:161583875-161583897 GTTTGCAAATATGCATGTCTAGG - Intronic
1021687608 7:23202489-23202511 GGTTTCAAATATATATCCCCTGG - Intergenic
1022240984 7:28512218-28512240 ACTCCCAAATCTGCATCTCCAGG - Intronic
1030486104 7:110169983-110170005 GGTTCCCAAGACTCATCTCCAGG - Intergenic
1032653487 7:133903691-133903713 GCTGCCAAATATCTATCTCCAGG - Intronic
1036809272 8:11856235-11856257 GTTTCTAAATCTGCATGTCCTGG + Intronic
1038397180 8:27255377-27255399 GTTTCCAAATGAGAATCTCCAGG + Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1040709453 8:50170842-50170864 GGTTCCTAATGGGCACCTCCTGG + Intronic
1043973076 8:86554304-86554326 AGTTCCAAATATTCACTTCCAGG - Intronic
1045375542 8:101570403-101570425 GTTTCTAAGGATGCATCTCCTGG - Intronic
1045429803 8:102103039-102103061 GGATCCAGATATGCTTCTCTTGG + Intronic
1050276228 9:4003694-4003716 GGTTCCAAATAAGGTGCTCCAGG + Intronic
1051756345 9:20405003-20405025 GGTTGCACTCATGCATCTCCGGG - Intronic
1059572022 9:115448311-115448333 GTTTGCAAATACGTATCTCCTGG + Intergenic
1203380754 Un_KI270435v1:36705-36727 GGCTCCAAATATGCACTTGCAGG - Intergenic
1191970506 X:66809994-66810016 GCTTACAAATATGTATCCCCAGG + Intergenic
1195016412 X:100786122-100786144 AGTTCCTTATATGCATCTGCTGG - Intergenic
1196736962 X:118988718-118988740 TTTTTCAAATATCCATCTCCTGG + Intronic
1198325367 X:135565884-135565906 GGCTTCAAATATCCATCTCCAGG + Intronic
1200768771 Y:7104503-7104525 GATTACAAACATGCACCTCCAGG + Intergenic
1201638829 Y:16156492-16156514 GGTTCTAAACATACATCCCCTGG - Intergenic