ID: 1012225799

View in Genome Browser
Species Human (GRCh38)
Location 6:96702051-96702073
Sequence CCTTATCTTCTGTAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012225793_1012225799 10 Left 1012225793 6:96702018-96702040 CCTAAAGGCTTCTATGGGTGACC No data
Right 1012225799 6:96702051-96702073 CCTTATCTTCTGTAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012225799 Original CRISPR CCTTATCTTCTGTAGCTGCA GGG Intergenic
No off target data available for this crispr