ID: 1012226526

View in Genome Browser
Species Human (GRCh38)
Location 6:96710040-96710062
Sequence GTGCTAAGCAGACCAAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012226524_1012226526 6 Left 1012226524 6:96710011-96710033 CCAGAGTTCATAAGTTGCAGAAG No data
Right 1012226526 6:96710040-96710062 GTGCTAAGCAGACCAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012226526 Original CRISPR GTGCTAAGCAGACCAAAATT GGG Intergenic
No off target data available for this crispr