ID: 1012226908

View in Genome Browser
Species Human (GRCh38)
Location 6:96715011-96715033
Sequence GGCCATGGGGCCATAGTAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012226904_1012226908 -7 Left 1012226904 6:96714995-96715017 CCGAGCAGGTACGGGCGGCCATG No data
Right 1012226908 6:96715011-96715033 GGCCATGGGGCCATAGTAAGCGG No data
1012226903_1012226908 -6 Left 1012226903 6:96714994-96715016 CCCGAGCAGGTACGGGCGGCCAT No data
Right 1012226908 6:96715011-96715033 GGCCATGGGGCCATAGTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012226908 Original CRISPR GGCCATGGGGCCATAGTAAG CGG Intergenic
No off target data available for this crispr