ID: 1012226999

View in Genome Browser
Species Human (GRCh38)
Location 6:96716212-96716234
Sequence CAGTGGTACTCTGGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012226994_1012226999 -8 Left 1012226994 6:96716197-96716219 CCAAGAACTGAGGAGCAGTGGTA No data
Right 1012226999 6:96716212-96716234 CAGTGGTACTCTGGGGAATAGGG No data
1012226992_1012226999 -1 Left 1012226992 6:96716190-96716212 CCGACATCCAAGAACTGAGGAGC No data
Right 1012226999 6:96716212-96716234 CAGTGGTACTCTGGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012226999 Original CRISPR CAGTGGTACTCTGGGGAATA GGG Intergenic
No off target data available for this crispr