ID: 1012230724

View in Genome Browser
Species Human (GRCh38)
Location 6:96758270-96758292
Sequence GGAGAACAGCACCAAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012230724_1012230731 1 Left 1012230724 6:96758270-96758292 CCATCCCCTTGGTGCTGTTCTCC No data
Right 1012230731 6:96758294-96758316 GGTAGAGTTCTTAGGAGATCTGG No data
1012230724_1012230729 -7 Left 1012230724 6:96758270-96758292 CCATCCCCTTGGTGCTGTTCTCC No data
Right 1012230729 6:96758286-96758308 GTTCTCCTGGTAGAGTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012230724 Original CRISPR GGAGAACAGCACCAAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr