ID: 1012238266

View in Genome Browser
Species Human (GRCh38)
Location 6:96843149-96843171
Sequence CACCAGCCACCCGAGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012238266_1012238272 21 Left 1012238266 6:96843149-96843171 CCATCTTTCTCGGGTGGCTGGTG No data
Right 1012238272 6:96843193-96843215 CCTCCATCTTGGGATGTCCATGG No data
1012238266_1012238270 11 Left 1012238266 6:96843149-96843171 CCATCTTTCTCGGGTGGCTGGTG No data
Right 1012238270 6:96843183-96843205 GCTCTGGCTGCCTCCATCTTGGG No data
1012238266_1012238267 -5 Left 1012238266 6:96843149-96843171 CCATCTTTCTCGGGTGGCTGGTG No data
Right 1012238267 6:96843167-96843189 TGGTGTCCAGTGACTAGCTCTGG No data
1012238266_1012238269 10 Left 1012238266 6:96843149-96843171 CCATCTTTCTCGGGTGGCTGGTG No data
Right 1012238269 6:96843182-96843204 AGCTCTGGCTGCCTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012238266 Original CRISPR CACCAGCCACCCGAGAAAGA TGG (reversed) Intergenic