ID: 1012245898

View in Genome Browser
Species Human (GRCh38)
Location 6:96925084-96925106
Sequence GCTGCTGGTGCGCCAAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012245887_1012245898 10 Left 1012245887 6:96925051-96925073 CCTGTTCTGCAGACCTGAGGAAG 0: 1
1: 0
2: 5
3: 23
4: 224
Right 1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG 0: 1
1: 0
2: 2
3: 7
4: 139
1012245893_1012245898 -3 Left 1012245893 6:96925064-96925086 CCTGAGGAAGAGGGTGGGAGGCT 0: 1
1: 1
2: 1
3: 56
4: 435
Right 1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG 0: 1
1: 0
2: 2
3: 7
4: 139
1012245884_1012245898 29 Left 1012245884 6:96925032-96925054 CCAGTCTCTCTCCTTGTAACCTG 0: 1
1: 0
2: 1
3: 30
4: 280
Right 1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG 0: 1
1: 0
2: 2
3: 7
4: 139
1012245885_1012245898 18 Left 1012245885 6:96925043-96925065 CCTTGTAACCTGTTCTGCAGACC 0: 1
1: 1
2: 1
3: 5
4: 101
Right 1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG 0: 1
1: 0
2: 2
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012245898 Original CRISPR GCTGCTGGTGCGCCAAGTGG GGG Intronic
900274637 1:1816314-1816336 ACAGCTGGTGCTCCAAGTGATGG - Intronic
900342987 1:2197436-2197458 GCTGCGGGTGCCCCAAGGGTAGG + Intronic
905583529 1:39100102-39100124 GCTGCTGGTGGGTTAATTGGTGG + Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906140489 1:43531229-43531251 GCTGCGGGCGCGGCAGGTGGGGG - Intronic
907732422 1:57079950-57079972 GCTGCTGCTGCCTCTAGTGGCGG - Intronic
908791980 1:67791868-67791890 GCTGCTGATGGGCCAAGGAGTGG - Intronic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
915590693 1:156868563-156868585 GCTGCTGCGGTGCCAGGTGGAGG + Exonic
917292166 1:173481668-173481690 GCTGCTGGCAGGCCAAGAGGAGG - Intronic
917472324 1:175336540-175336562 GCTGCTTTAGGGCCAAGTGGTGG + Intronic
917920837 1:179748298-179748320 GCTGCTGTTGCCCACAGTGGTGG + Intronic
917986776 1:180327556-180327578 CCTGCTGGGGCGACAATTGGTGG + Intronic
918715598 1:187782467-187782489 GCTGCTGTTGCTCTTAGTGGTGG + Intergenic
922790289 1:228307440-228307462 GCTGCTGATCCACCAACTGGAGG + Exonic
924352182 1:243126582-243126604 GCTTCTGGTTGGCCAAGTGTTGG + Exonic
924442987 1:244102353-244102375 GCTGCTGGTTTGTCATGTGGAGG - Intergenic
1065271355 10:24036818-24036840 GTTGATGGTGGGCCTAGTGGAGG - Intronic
1074405509 10:113177418-113177440 GCTGCTGCTCGGACAAGTGGGGG + Intergenic
1077049142 11:558928-558950 GCTGCAGGTGCGCCTGCTGGAGG + Exonic
1077909779 11:6563881-6563903 CCTGCTGCTGCAGCAAGTGGAGG + Exonic
1080376791 11:31722842-31722864 GCTGCTTGTGTCCCAAGTTGTGG - Intronic
1081746096 11:45473481-45473503 CCTGCTGGTGGGCCATGGGGAGG + Intergenic
1084219815 11:67671013-67671035 GCTGCTTGAGCGCCGGGTGGAGG - Intronic
1085154660 11:74282513-74282535 GCAGCTGGAGCGTCAAGTGCCGG + Intronic
1087806273 11:102558747-102558769 GATGCTGGTGCCCAAGGTGGAGG + Intergenic
1089505407 11:118958802-118958824 GGGGCTGGTGCCCCATGTGGAGG + Intergenic
1092489510 12:8932717-8932739 GCTGCTGCTGCGCCAACTGGAGG - Exonic
1096946425 12:55413455-55413477 GCTGCTGCTGCGCCAACTGGAGG + Intergenic
1100613556 12:96212782-96212804 GCTACCGGTGAGCCACGTGGCGG + Intronic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1110573060 13:77026922-77026944 GCTGCGGGAGCGCGAAGCGGGGG - Exonic
1111397085 13:87677755-87677777 GCTGCTGCTGCTGCAGGTGGTGG - Exonic
1119878272 14:78078627-78078649 GCTGCTGGTGGGTCCATTGGAGG + Intergenic
1122179853 14:99947046-99947068 ACTGCAGGTGCGCCACCTGGTGG + Intergenic
1122261136 14:100523684-100523706 TTTGCTGGTGGGCCGAGTGGTGG + Intronic
1122781713 14:104146561-104146583 CCTGCTGCTGCCCCACGTGGTGG + Intronic
1122997436 14:105272859-105272881 GCAGCTGGTTCCCCAGGTGGTGG + Exonic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1126348084 15:47717516-47717538 GCTGCTGCTGCTGCAAGGGGTGG + Intronic
1129810706 15:78507665-78507687 GCTGCCGGTGAGCCAAGGAGGGG + Intronic
1130817391 15:87452200-87452222 GCTGGTGTTTGGCCAAGTGGAGG - Intergenic
1133318913 16:4901029-4901051 GCTGGTGGACCACCAAGTGGAGG - Exonic
1134069977 16:11255010-11255032 GCTGCTGGAGCACTACGTGGCGG - Exonic
1136590423 16:31214945-31214967 GCAGCTGGCGCGCCTGGTGGAGG + Exonic
1143951914 17:10639381-10639403 CCTGCTGGTGCGCCTCTTGGAGG + Exonic
1144002670 17:11070383-11070405 GATGTTTGTGAGCCAAGTGGAGG + Intergenic
1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG + Intronic
1148855285 17:50575875-50575897 GGTGGTGGTGCACCAGGTGGTGG - Exonic
1151585802 17:75007765-75007787 GCTGCTGGTGCGAGAAGGGGTGG - Intergenic
1151948077 17:77330222-77330244 GCAGCAGGTGCTCCAAGAGGGGG - Intronic
1152717731 17:81907921-81907943 GCTGCTAGTGTCCCTAGTGGTGG - Intronic
1153522164 18:5963456-5963478 GCTGCTTGCGGGCCAGGTGGAGG - Intronic
1155517763 18:26640322-26640344 GCTACTGGTGAGGCAGGTGGTGG + Intronic
1158605539 18:58892752-58892774 GCTGAAGGTTCCCCAAGTGGGGG + Intronic
1160906252 19:1453028-1453050 GCAGCTGGTGAGGCAGGTGGAGG + Exonic
1161999039 19:7731581-7731603 GCAGCTGGTGCGCCATGCAGTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163013785 19:14441370-14441392 GCTGCTGGTGCAGCAGGTCGAGG - Exonic
1163433665 19:17282719-17282741 GCTGCTGCTGAGCCAAGGAGCGG + Exonic
1163704276 19:18803294-18803316 GCTGCTGGTGGGCCAAGGTGCGG + Intergenic
1165153552 19:33774434-33774456 GCTGCTGATTCTCCACGTGGAGG + Intergenic
1166043825 19:40218034-40218056 GCTGCTGGTGGGCCCGGGGGCGG + Exonic
1166091661 19:40513213-40513235 GGTGCTGGCGCGCCAGGCGGCGG - Exonic
1166863063 19:45820836-45820858 CCTGCTGGTCCGCCACTTGGTGG - Intronic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
924978133 2:196411-196433 GCTGCTGGAGCTCAAAGTTGTGG + Intergenic
926065541 2:9836738-9836760 ACTCCTGGTGAGCCAACTGGTGG - Intergenic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
933650500 2:84846526-84846548 CCTGCTGGTGAGCACAGTGGGGG - Intronic
933671038 2:85007507-85007529 GCTGGAGGTGGGCCAAGTGAAGG - Intronic
934659989 2:96138211-96138233 GCTCCTGGGGGGCCAAGGGGAGG - Intronic
937100366 2:119263868-119263890 CCTGCTGCTGCCCCAGGTGGAGG - Exonic
937598165 2:123695310-123695332 GGTGTTGGTGCTCCAAGTTGTGG + Intergenic
937644419 2:124250291-124250313 GCTGCTGGTGCTCCTGGTTGGGG + Intronic
938409070 2:131048850-131048872 CCTGCTGCTGCGCCCAATGGAGG + Exonic
943663220 2:190581071-190581093 ACTGCTGGTGAGCTAAGTTGTGG - Intergenic
943782986 2:191845586-191845608 GCTCTTGTTCCGCCAAGTGGTGG - Intronic
946417540 2:219547924-219547946 ACTGCTGGGGCGCTACGTGGTGG + Exonic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
1169478110 20:5950481-5950503 GCTCCTAGTGCGCCAGGTTGTGG - Exonic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1178535036 21:33403790-33403812 CCTGCGGGTGCCCCAGGTGGGGG + Intronic
1178763672 21:35428815-35428837 GCTGCTTGTGGGCCAGGTGATGG + Intronic
1179508023 21:41854731-41854753 GATGCTGGTGCGGCCAGCGGCGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1182470299 22:30544234-30544256 GCTGCTGGAGAGCCAAGGAGGGG - Intronic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1183481287 22:38066948-38066970 GGTGCTGGGGCACCAAGGGGAGG - Intronic
1183490007 22:38111102-38111124 GCTCCTGCTCCGGCAAGTGGAGG - Intergenic
1184173788 22:42774695-42774717 GCTGCAGGTGCGTCCAGAGGAGG - Intergenic
1184786924 22:46676496-46676518 GCTGCCTGTGTGCCCAGTGGAGG + Intronic
1185038279 22:48490580-48490602 GCGGCTGGTGGGGTAAGTGGGGG + Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950304601 3:11908232-11908254 GCTGCTGGTGCTCAGGGTGGAGG - Intergenic
950416356 3:12871027-12871049 GCTTCTGGTGCTCTGAGTGGAGG - Intronic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
961177579 3:124848517-124848539 GCTACAGGTTCGCCAGGTGGAGG - Exonic
961613423 3:128159682-128159704 GCAGCTGGTGGGCCCACTGGAGG - Intronic
962844129 3:139260461-139260483 GCTGCTGGTTCTCCTAGAGGAGG - Intronic
965768372 3:172154903-172154925 GGTGCTGGTGGGACAAGTCGGGG + Intronic
967147784 3:186620667-186620689 AGTCCAGGTGCGCCAAGTGGAGG - Exonic
968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG + Intergenic
968789328 4:2648655-2648677 GCTGCAGCTGTGCCATGTGGGGG + Intronic
969105569 4:4804848-4804870 GCAGCTGGTGCGGCCAGTGTGGG - Intergenic
979249761 4:118553945-118553967 GCTTCTGGTTGGCCAAGTGTTGG - Intergenic
980130266 4:128811279-128811301 GCGGCTGCTGCTCAAAGTGGCGG + Intronic
983615161 4:169695648-169695670 GCTTTTGGTGCACCAATTGGAGG + Exonic
984950392 4:185003684-185003706 GCTGTAGGTACGTCAAGTGGAGG - Intergenic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995650484 5:114362703-114362725 GCTGGTGGTGCGCCGGGTGCGGG - Exonic
997527197 5:134561019-134561041 GCCCCTGGAGAGCCAAGTGGGGG - Intronic
999694428 5:154176226-154176248 GCTGGAGGTGTGCCTAGTGGGGG + Intronic
1001237530 5:170042715-170042737 GCTGCTGGTTTGCCTAGTGGTGG - Intronic
1005159986 6:22848216-22848238 GCTGCTGGGGCTACATGTGGAGG - Intergenic
1008487868 6:52054821-52054843 TCTGCAGGGGCGCCCAGTGGAGG - Intronic
1008973878 6:57401847-57401869 GCTGCAGTTGAGCCAAGGGGAGG - Intronic
1009162768 6:60303352-60303374 GCTGCAGTTGAGCCAAGGGGAGG - Intergenic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1019413438 7:916732-916754 GCTGGCTGTGTGCCAAGTGGGGG + Intronic
1029403497 7:100359349-100359371 GCTGCTGGGCCTCCAGGTGGTGG - Exonic
1033227858 7:139575145-139575167 GCTGCTGCTGCTGGAAGTGGGGG + Exonic
1034050386 7:147977898-147977920 CCTGCCAGTGAGCCAAGTGGTGG + Exonic
1034731177 7:153388779-153388801 GCTGCTGCTGCTCCTGGTGGAGG - Intergenic
1035686672 8:1528482-1528504 GCTGCTGCTGCTCCTGGTGGAGG - Intronic
1036579060 8:10055485-10055507 GCTGCTGCTGCGGCAGGTGGGGG - Intronic
1048486015 8:134848124-134848146 ACAGCTGCTGGGCCAAGTGGTGG + Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049597611 8:143491966-143491988 GCGCCTGGTGCACCAGGTGGAGG - Intronic
1052915168 9:33919497-33919519 GGAGCCGGAGCGCCAAGTGGAGG + Exonic
1056985588 9:91361640-91361662 GCTGCGGGTGCGGCACCTGGAGG - Exonic
1059119780 9:111631497-111631519 GCTGCTGGTGCGGCCCGCGGGGG + Exonic
1060069509 9:120533953-120533975 GCTGATGGTGACCAAAGTGGAGG - Intronic
1060104558 9:120865718-120865740 GCTGCAGGAGCTCCCAGTGGTGG + Exonic
1060550550 9:124482868-124482890 GCTGCTGCTGTGCCTGGTGGAGG - Exonic
1061024793 9:128041506-128041528 GCTGCTGGTGTCTGAAGTGGGGG + Intergenic
1061317114 9:129803257-129803279 GCTGCTGGCGGCCCGAGTGGTGG + Exonic
1062290117 9:135790628-135790650 GCTGCTGGCCAGCCAGGTGGGGG - Intronic
1062686150 9:137814492-137814514 GCTGCTGGTACGACAAGGTGAGG + Exonic
1192196580 X:69032809-69032831 GCTGCTGCTGCTCCCAGAGGTGG + Intergenic
1194265179 X:91744235-91744257 GCTGCTGCTGCTGCCAGTGGTGG + Intergenic
1198442707 X:136679551-136679573 GCTGCTGATGGTCTAAGTGGAGG + Exonic
1200126617 X:153818289-153818311 GCTCCTGTAGCCCCAAGTGGTGG + Intronic
1200582331 Y:4964681-4964703 GCTGCTGCTGCTGCCAGTGGTGG + Intergenic
1202015792 Y:20405256-20405278 GTTACTGGTGTGGCAAGTGGGGG - Intergenic