ID: 1012247043

View in Genome Browser
Species Human (GRCh38)
Location 6:96937717-96937739
Sequence CTGTGAGGATGGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 642}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012247043 Original CRISPR CTGTGAGGATGGAGGGTAGA GGG (reversed) Intronic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900499386 1:2993362-2993384 ATGGGAGGGTGGAGGGTAGGAGG + Intergenic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
900726932 1:4222669-4222691 CTGTGACGATGGAGTGCAGGAGG + Intergenic
900745226 1:4356368-4356390 CTGTGAGGCTGCAGGGTAAGGGG - Intergenic
900902103 1:5524069-5524091 ATGAGAAGACGGAGGGTAGAGGG - Intergenic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
902562212 1:17284641-17284663 TTGGGAGGGTGGAGGGCAGAGGG - Intergenic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
903279038 1:22239591-22239613 CCGATAGGCTGGAGGGTAGAGGG - Intergenic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903847280 1:26285823-26285845 CTGTGTGGAGGGATCGTAGAAGG + Exonic
904320546 1:29695245-29695267 CTGGGAGGATGGATGGCACAAGG + Intergenic
904358151 1:29954756-29954778 CTGGGAGGATGGATGGCACAAGG + Intergenic
904437166 1:30506506-30506528 CTGGGAGGATGGATGGCACAAGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904960951 1:34332421-34332443 CTGTAAGGATGCAGGGGTGAAGG - Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907313393 1:53552635-53552657 CTGGGAGGATGGATGGTGGAGGG - Intronic
907744155 1:57196017-57196039 CTGTGAGGATGGGGTGGTGATGG + Intronic
907948333 1:59156158-59156180 CAGAGAGGATGGGAGGTAGAAGG + Intergenic
908352014 1:63295349-63295371 CTCTGAGGATTGAGAGTGGATGG + Intergenic
908950289 1:69553048-69553070 GTGTGATAATTGAGGGTAGAAGG - Intergenic
909399597 1:75212338-75212360 ACTTGAGGGTGGAGGGTAGAAGG - Intronic
909629481 1:77756585-77756607 CAGTGAGGATTGACTGTAGATGG + Intronic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
911245101 1:95508331-95508353 ATTTGAGGGTGGAGGGTAGGAGG - Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912087510 1:106027929-106027951 TTGATAGGATGGAGGGTAGTTGG + Intergenic
912283606 1:108344453-108344475 ATTTGAGGGTGGAGGGTAGGAGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912859248 1:113198383-113198405 CTGTGAACATGAAGGGTATATGG - Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
914049299 1:144118481-144118503 CTTTGAGGGTGGAGGGTGGGAGG + Intergenic
914129885 1:144846963-144846985 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
915319071 1:155046269-155046291 AGGTGAGGGTGGAGGGTAAAAGG + Intronic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915701957 1:157804727-157804749 CTGTGTGGATGGTGGGTACTGGG - Intronic
917192214 1:172430009-172430031 CTGGGAGGAAGGGGTGTAGAGGG + Intronic
917568983 1:176244257-176244279 CTAGCAGGATGGAGGGAAGAGGG - Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918637071 1:186789632-186789654 GTGTGAGGACAGAGGGTATATGG - Intergenic
918786068 1:188765539-188765561 CTTTTAGGGTGGAGGGTAGGAGG - Intergenic
919362334 1:196610727-196610749 CTGGGATGCTGGAGGTTAGAGGG + Intergenic
919757614 1:201075616-201075638 CTGTATGGAGGGAGGATAGAGGG + Intronic
919920146 1:202162486-202162508 CTGGGTGGATGTGGGGTAGAGGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920219205 1:204383948-204383970 AGATGAGGATGGAGGGTAGAGGG + Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
921363576 1:214353074-214353096 TTGGGGGGATGGAGGGTACAGGG - Exonic
921685700 1:218086751-218086773 CTGTGGGGAAGGATGTTAGACGG - Intergenic
923128443 1:231053573-231053595 CTGTCAGGATGGAGAAGAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923531744 1:234817534-234817556 CTTTGATGATGGAGGGTGGAGGG + Intergenic
923877575 1:238065923-238065945 ATGAGAGAATGGAGGGTAGTTGG - Intergenic
923906219 1:238388071-238388093 CTGAGATGATCTAGGGTAGAGGG + Intergenic
924067429 1:240238932-240238954 CTGTGACGATAGAAGTTAGAAGG + Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924737513 1:246771591-246771613 CTTTGAGGTTGGAGGGTGGGAGG - Intergenic
1063092507 10:2879713-2879735 CTGTGAGCCTGGAGGGTGGCAGG + Intergenic
1063694547 10:8320588-8320610 CTCAGAGGGTGGAGGGTAGGAGG - Intergenic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1066462696 10:35625441-35625463 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1066753413 10:38683861-38683883 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068722885 10:60265992-60266014 CTTGAAGCATGGAGGGTAGAGGG - Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069785343 10:70984243-70984265 CTAGGAGGATGGAGGGTGGCGGG - Intergenic
1070254283 10:74800686-74800708 TGGTGAGGATGCAGGGTAAAGGG + Intergenic
1070286138 10:75085307-75085329 TTGGGAGGATGGCGGGTCGATGG - Intergenic
1070414576 10:76177746-76177768 CAATGAGGATTGAGGGGAGAGGG + Intronic
1071063269 10:81599529-81599551 ATTGGAGGGTGGAGGGTAGAAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1072144643 10:92624038-92624060 CTTTGAGGGTGGAGGGTAAGAGG - Intronic
1072374871 10:94804126-94804148 CTTTGAGGATGGAATGGAGAGGG + Intronic
1073429054 10:103474424-103474446 ATGAGAGGATGGATGATAGATGG - Intronic
1073787306 10:106903958-106903980 AAGTGAGGATTGAGGGAAGAAGG - Intronic
1074746184 10:116534850-116534872 ATTTGAGGGTGGAGGGTAGAAGG - Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075469308 10:122676116-122676138 CCGTGAGGATGCAGGCTAGAGGG + Intergenic
1075726032 10:124611394-124611416 CTTGGAGGATGGAAGGGAGAGGG + Intronic
1075902219 10:126052117-126052139 CTGTGAGGATGGAGCACAGGAGG - Intronic
1076114059 10:127883029-127883051 CTGGGAGGATGGAGCCCAGATGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076586207 10:131549319-131549341 GTGTGAGGATGGAGGGAACGGGG + Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077159580 11:1106551-1106573 ATGGGAGGGTGGATGGTAGATGG - Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077363664 11:2152539-2152561 CCGTGAGGTTGGAAGGGAGAGGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077964307 11:7111498-7111520 CTGTGAAGAGGGAGGGTCGTAGG - Intergenic
1079115177 11:17635891-17635913 CTGTCAGGCTGGAGGGTGGGAGG + Intronic
1079304220 11:19308310-19308332 CTCGGAGGCTGGAGGGTGGAAGG - Intergenic
1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG + Intergenic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1081294517 11:41369374-41369396 CTAAGAGGGTGGAGGGTAGAGGG + Intronic
1081555030 11:44151139-44151161 CTATGAGGATGGGGGATATATGG - Intronic
1082637841 11:55618365-55618387 ATCTGAGGATGGAGGGTGGCAGG - Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1082884991 11:58071905-58071927 TTTTGAGGGTGGAGGGTAGGAGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084609812 11:70194913-70194935 ATGTGTGGATGGATGGTAGATGG + Intergenic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085615295 11:77993472-77993494 ATGTGAGGATGGGTGGAAGAGGG + Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087332626 11:96800156-96800178 ATCAGAGGGTGGAGGGTAGAGGG - Intergenic
1089152831 11:116377416-116377438 ATGTGAGCATGGAAGATAGATGG + Intergenic
1089395037 11:118131204-118131226 TGGTAAGGAAGGAGGGTAGATGG - Intergenic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092720119 12:11433022-11433044 GTGTAAGCAGGGAGGGTAGAAGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097173384 12:57129347-57129369 TTGTGAGGATGTAGGGGAGGCGG - Intronic
1097319959 12:58214438-58214460 ATTTGAGGGTGGAGGGTAGGAGG - Intergenic
1098142487 12:67464447-67464469 TCATGAAGATGGAGGGTAGAAGG - Intergenic
1098381064 12:69870027-69870049 CTGAGAGGAAGGAGTTTAGAAGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1100695554 12:97089020-97089042 GTGGGAGGAGTGAGGGTAGAGGG - Intergenic
1100722206 12:97371051-97371073 ATGAGAGGATGGAGGGGGGATGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101251484 12:102939947-102939969 CTGAGAGGATGGAGGCAAGCAGG + Intronic
1101288302 12:103339352-103339374 TTCAGAGGGTGGAGGGTAGAAGG - Intronic
1101301709 12:103489672-103489694 CTGTGAGGCTGCAGTGTGGATGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1102920646 12:116789195-116789217 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920697 12:116789423-116789445 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920740 12:116789597-116789619 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920811 12:116789895-116789917 GTGGGTGGATGGATGGTAGATGG + Intronic
1103871889 12:124098223-124098245 CTGTGAGGATGGTGGGGCGCAGG + Intronic
1104195902 12:126537780-126537802 ATTGGAGGGTGGAGGGTAGAAGG + Intergenic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1104402048 12:128484359-128484381 GTGAGAGGAAGGAGGGTAGCAGG + Intronic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1106666315 13:31854491-31854513 TGGTGAGGCTGGTGGGTAGAGGG + Intergenic
1106752417 13:32788638-32788660 CAATGATGATGGTGGGTAGAAGG - Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1109536204 13:63722979-63723001 GTGAGAGGAAGGAGGGGAGATGG + Intergenic
1109539896 13:63763307-63763329 GTGAGAGGAAGGAGGGGAGATGG - Intergenic
1110149591 13:72234763-72234785 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110716018 13:78705043-78705065 ATCTGAGAATGGAGGGTGGAGGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116641239 14:47466163-47466185 ATGTGAGGGTGGAGGGTGGGAGG + Intronic
1117160155 14:52981587-52981609 ATGTGGGGGTGGAGGGTATATGG - Intergenic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118095055 14:62527033-62527055 ATCAGAGGATGGAGGGTGGAAGG + Intergenic
1118762682 14:68890287-68890309 CTGTGGGGATGGGAGGTACAGGG + Intronic
1118976671 14:70683850-70683872 CTGTTAGGATGCAGTGAAGAGGG + Intergenic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121727573 14:96164447-96164469 CTTTGAGGATGGAGGAGGGAGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122140948 14:99662747-99662769 GTGGAAGGATGGAGGGAAGAAGG + Intronic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122458710 14:101878135-101878157 TTGTAAGGAGGGATGGTAGAAGG - Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1124035828 15:26052936-26052958 GTGTGAGGATGTAGGGTGAAAGG - Intergenic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125321108 15:38490015-38490037 TAGTGAGGAAGGAGGGTACATGG + Exonic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1127334314 15:57968451-57968473 CTGGGAGGAAGGAAGGGAGAAGG - Intronic
1127756187 15:62094601-62094623 ATGAGAGAATGGAGGGGAGAGGG + Intergenic
1127806024 15:62521284-62521306 CCGTGAGGGTGGGGGGTACAGGG + Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129752703 15:78077200-78077222 CTTGGAGGAAGGAGGGTGGATGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130903886 15:88226596-88226618 ATGTCAGGATGGAGGGCAGTGGG - Intronic
1130989776 15:88869467-88869489 GGGTGAGGATGGAGGGTGGGAGG - Intronic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133512023 16:6468938-6468960 ATCTGAGGGTGGAGGGTGGAAGG - Intronic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1135997600 16:27263539-27263561 ATTTGAGGATGGAGGGTGGGAGG + Intronic
1136050342 16:27645739-27645761 CGGTCAGGAAGAAGGGTAGAAGG + Intronic
1136670432 16:31851666-31851688 CTTGGAAGATGGAGGCTAGATGG - Intergenic
1136729295 16:32393130-32393152 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1139504478 16:67392195-67392217 GTGTGAAGATGGAGGATGGAGGG - Intronic
1140245453 16:73244349-73244371 CTTGGAGGATGGAGGAGAGAAGG - Intergenic
1141033736 16:80610986-80611008 TGGTGAGGATGGTGGGGAGAGGG - Intronic
1141096795 16:81168573-81168595 GTGGGTGGATGGATGGTAGATGG + Intergenic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142038769 16:87879103-87879125 CTGTGAGGATGGAAGTTTGTAGG + Intergenic
1202997101 16_KI270728v1_random:124391-124413 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1203023788 16_KI270728v1_random:436733-436755 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1203137859 16_KI270728v1_random:1740673-1740695 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1142912129 17:3103131-3103153 CTGATGGGAGGGAGGGTAGAGGG + Intergenic
1143370009 17:6433748-6433770 ATGTGAAGATGGAGGGAACAAGG - Intronic
1143376070 17:6468443-6468465 CTGTGAGGTTGGGGGGTTGCAGG - Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144162032 17:12569099-12569121 AAGTGAGGATGCTGGGTAGAGGG - Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1147140948 17:38460452-38460474 ATCTGAGGGTGGCGGGTAGAAGG - Intronic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1147888037 17:43697718-43697740 CTGTGAGGAAGGCGTGTGGAAGG + Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1148967104 17:51445300-51445322 CTTTGAGGGTGGAGGGTAGGAGG + Intergenic
1149328301 17:55555735-55555757 CTCTGAAGATGGTGGGAAGATGG - Intergenic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149639502 17:58193639-58193661 CTGGGAGGAGAGAGGGTAAAGGG + Intronic
1150392097 17:64796145-64796167 ATGGGTGGATGGTGGGTAGATGG - Intergenic
1151280553 17:73071000-73071022 CTCTGAGGTTGGGGGGTGGAGGG - Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1151560908 17:74869055-74869077 CTGGGAGGATGGGGGATTGATGG - Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1152054413 17:78012336-78012358 CCTTGAGGGTGGAGGGTGGAAGG + Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1152504768 17:80741536-80741558 CCATGAGGCTGGAGGGTGGATGG + Intronic
1152767172 17:82147904-82147926 GTGGGTGGATGGATGGTAGATGG + Intronic
1152767205 17:82148019-82148041 GTGGGTGGATGGATGGTAGATGG + Intronic
1152973113 18:184801-184823 GTATAATGATGGAGGGTAGAAGG + Intronic
1153191777 18:2548825-2548847 CTGTGAGGTTGAAGGGTAAAGGG - Intronic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1154018435 18:10641080-10641102 CTTTGAGGATGTATGCTAGAAGG - Intergenic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154186438 18:12188495-12188517 CTTTGAGGATGTATGCTAGAAGG + Intergenic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1155060081 18:22220604-22220626 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1155276193 18:24189829-24189851 CTGTGAGGACTGAGGACAGAAGG - Intronic
1156352356 18:36311996-36312018 CTGGGAGGCTTGAGGGTTGAAGG - Intronic
1156525112 18:37759647-37759669 CTGTGGTGATGTGGGGTAGATGG - Intergenic
1157085207 18:44573436-44573458 AAGGGAGAATGGAGGGTAGAAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158959177 18:62574467-62574489 CTGTGTGGAAGGAAGGTTGATGG - Exonic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160040484 18:75340401-75340423 CTGGGAGGATGGACGGCGGAGGG + Intergenic
1160687608 19:443950-443972 GTGGGTGGATGGAGGGTGGATGG + Intronic
1160797676 19:953382-953404 CTGTGAGGAGAGAGGGTGGCGGG - Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1161046099 19:2135873-2135895 CTGGGAGGGAGGAGGGTGGAGGG - Intronic
1161398876 19:4058977-4058999 CTGGGAGCAGGGAGGGTAGGAGG + Intronic
1161456735 19:4373377-4373399 CTGAGAGGCTGGAGGCTCGAAGG - Intronic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163076119 19:14893320-14893342 CTATGAAGAAGGAGGTTAGAAGG + Intergenic
1163609837 19:18295127-18295149 GTGGGTGGATGGATGGTAGATGG - Intergenic
1163912913 19:20213659-20213681 AGTTGAGGCTGGAGGGTAGAAGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1164836391 19:31357709-31357731 CTGTGAGGGTGCAGGGTCGTTGG - Intergenic
1165104389 19:33460489-33460511 CTCTGAAGATGGTGGGAAGATGG - Intronic
1165149650 19:33753425-33753447 GTGGGAGGATGGAGGGTGGGTGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1167089301 19:47332348-47332370 CGGTAAGGATGGAGGCTACAAGG + Exonic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168072079 19:53958984-53959006 CTGAGAGGATGGGGGAGAGAGGG - Intergenic
1202688747 1_KI270712v1_random:71376-71398 CTTTGAGGGTGGAGGGTGGGAGG + Intergenic
925546755 2:5024719-5024741 CTGTGAGGAGTGAGGGGTGAGGG - Intergenic
927008477 2:18877424-18877446 ATCAGAGGGTGGAGGGTAGAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928466513 2:31527736-31527758 CTGTGAGGAGGGGTGGCAGAGGG - Intronic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
930966914 2:57340032-57340054 CTTGGAGGGTGGAGGGTGGAGGG - Intergenic
931779689 2:65568345-65568367 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934048361 2:88190293-88190315 CTGTGAGGATGGTTGGGAGCAGG + Intergenic
934185595 2:89671041-89671063 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
934492474 2:94771057-94771079 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935124269 2:100209185-100209207 CTGGAAGGGTAGAGGGTAGAAGG - Intergenic
935225269 2:101047249-101047271 CTGGGAGCAGGGAGGGTAGGGGG - Intronic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937681479 2:124649272-124649294 CTCTGAGGATGCTGGGTAAAGGG - Intronic
937807125 2:126159611-126159633 ACTTGAGGGTGGAGGGTAGAAGG + Intergenic
937858596 2:126690741-126690763 CCTTGAGGATGGAGGGTTGGGGG - Intronic
937859097 2:126694328-126694350 CCTTGAGGATGGAGGGTTGAGGG - Intronic
938055871 2:128214403-128214425 ACCTGAGGATGGAGGGTGGAAGG - Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
939998910 2:148947806-148947828 CAGTGATGATGGAGGCCAGAGGG - Intronic
940537502 2:154964863-154964885 CTCTGAGAATGGAGTGTAAATGG + Intergenic
940546612 2:155096791-155096813 ATTTGAGGGTGGAGGGTAGGAGG - Intergenic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
942656091 2:178215532-178215554 CTGTGAGGTTGGAGTATAGACGG + Intronic
943676455 2:190720454-190720476 CTGTCAGGATGAAGTGCAGAGGG + Intergenic
943936378 2:193921241-193921263 ATTTGAGGGTGGAGGTTAGAAGG + Intergenic
944277195 2:197852247-197852269 CAGGGAGGATGGTGGGGAGATGG + Intronic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946090013 2:217213507-217213529 CCTTGAGGACGGAGGGTGGAAGG + Intergenic
946182042 2:217954747-217954769 CTGGGAGGCTGGATGGTGGAAGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
947434372 2:230060297-230060319 ATGAGAGGAGGGAGGCTAGATGG + Intronic
948265290 2:236631665-236631687 CGGTGAGGATGAAGGGTGCAAGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
948964601 2:241367954-241367976 ATGTGGGGGTGGAGGGTATATGG - Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168737101 20:149875-149897 CAGTGAGGATAGAGGATAGGAGG + Intergenic
1168984538 20:2036765-2036787 ATGGGTGGATGGTGGGTAGATGG + Intergenic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171390825 20:24800591-24800613 CTGGCAGGATGGAGGGGAGCTGG - Intergenic
1171456631 20:25276146-25276168 CTGGGAACATGGAGGGTAGCAGG + Intronic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172596249 20:36153222-36153244 CTATGAGGACCCAGGGTAGAAGG + Intronic
1173761985 20:45570030-45570052 ATGGGAGGTTGGAGGGTAGGAGG + Intronic
1174568033 20:51481068-51481090 AGGGGAGGATGGAGGGTGGACGG - Intronic
1175274984 20:57762253-57762275 CTGAGAGGATGGATTCTAGATGG + Intergenic
1175357029 20:58376600-58376622 CAGTCAGGATGGATGGAAGAAGG - Intergenic
1175662864 20:60832080-60832102 CTTGGAGGCTGGAGAGTAGAGGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175781016 20:61682132-61682154 ATGGGTGGATAGAGGGTAGATGG + Intronic
1175934969 20:62510200-62510222 CTGGAAGGGTGGAGGGTGGAGGG - Intergenic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176365285 21:6029107-6029129 GTGTGAGGATGCAGGGCAGATGG + Intergenic
1177418765 21:20828042-20828064 CTGTGAGCAAGTGGGGTAGAGGG + Intergenic
1177746394 21:25219668-25219690 CTGCATTGATGGAGGGTAGAAGG - Intergenic
1177750905 21:25282924-25282946 ACTTGAGGATGGAGGGTGGAAGG + Intergenic
1177772105 21:25528545-25528567 CTGTGAGGATAAAGAGTAGGAGG + Intergenic
1178538849 21:33432575-33432597 AGGTGAGGGTGGGGGGTAGAGGG + Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179292326 21:40029560-40029582 GTGTGAGGGTGGAGAGTAGGAGG + Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179758233 21:43509438-43509460 GTGTGAGGATGCAGGGCAGATGG - Intergenic
1180141936 21:45898287-45898309 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141940 21:45898313-45898335 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141950 21:45898365-45898387 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141955 21:45898391-45898413 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141960 21:45898417-45898439 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141994 21:45898557-45898579 CTGTGAGGATGGCGTGTAGAGGG - Intronic
1180142007 21:45898601-45898623 CCGTGAGGACGGTGTGTAGAGGG - Intronic
1180142021 21:45898645-45898667 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180142084 21:45898865-45898887 CTGTGAGGACGGCGTGCAGAGGG - Intronic
1180552679 22:16553225-16553247 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1181035839 22:20169386-20169408 CTGGGAGGCTGGGGGGTAGGAGG + Intergenic
1181363835 22:22358428-22358450 CTCTGAGGATGAAGGGGAGGAGG - Intergenic
1181536951 22:23551269-23551291 ATGAGAGGATGGATGGTGGATGG - Intergenic
1181548561 22:23620981-23621003 CTGTGAGGATGGAGTTCAGCGGG - Intronic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183142950 22:35961547-35961569 CTGTGAGGTTGGTGGGGAGTTGG - Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183505008 22:38203809-38203831 ATGGCAGGATGGTGGGTAGAAGG + Intronic
1183629871 22:39026436-39026458 CTGTGAGGAGGTGGGGTTGAGGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184257919 22:43297472-43297494 CTGTGAGGACCGAGTGGAGATGG - Intronic
1184332848 22:43836971-43836993 CTGCGAGGCTGGAGGGCAAAGGG - Intronic
1184594103 22:45503646-45503668 CTGGGAGGATGGAGGGGATGCGG + Intronic
1184852832 22:47130480-47130502 CTCTCTGGATGGAGGGTGGAGGG + Intronic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1185104457 22:48859323-48859345 GTGGATGGATGGAGGGTAGAAGG - Intergenic
1185376400 22:50484453-50484475 CTGAGAGGCTGCAGGGTGGAGGG + Exonic
949745821 3:7291071-7291093 CAGTGAGGATGCTGGGAAGAGGG - Intronic
950077250 3:10195890-10195912 GTTTGAGGAGGGAGGGTGGAGGG + Intronic
950395993 3:12734543-12734565 CTGCAAGGATGGAAGGCAGAGGG - Exonic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952917413 3:38258305-38258327 ATGTGAGGATGGAAGGTTAAAGG + Intergenic
954148748 3:48647207-48647229 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148759 3:48647235-48647257 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148805 3:48647362-48647384 GTGGGAGGGTGGAGGGTGGAAGG + Intronic
954148835 3:48647440-48647462 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148846 3:48647468-48647490 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148887 3:48647571-48647593 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954387403 3:50251514-50251536 CTGAGCAGATGGAGGCTAGAAGG - Intronic
954503480 3:51044425-51044447 TTCAGAGGATGGAGGGTAGGAGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955550410 3:60078857-60078879 ATCTGAGGGAGGAGGGTAGAGGG + Intronic
955588303 3:60506252-60506274 CTTTGAGGGTGGAGGGTAGGTGG + Intronic
955846080 3:63164324-63164346 ATTTGAGGGTAGAGGGTAGAAGG + Intergenic
955937808 3:64119216-64119238 ATTGGAGGGTGGAGGGTAGAAGG + Intronic
956014273 3:64864790-64864812 GTGTCAGGATGGAGTGTAGGGGG + Intergenic
956033630 3:65066722-65066744 CTCTGAGGCTGGAGGGTACAGGG - Intergenic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956578030 3:70777441-70777463 CCTTGAGGGTGGAGGGTAGAAGG + Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
958822624 3:98993045-98993067 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
960357251 3:116668804-116668826 CTGGGATGATGGAAAGTAGAAGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961865860 3:129953061-129953083 GGGTGAGGATGGAGTGGAGAGGG - Intergenic
962455700 3:135563741-135563763 CTGAGAGGGTTGATGGTAGAGGG - Intergenic
962813526 3:138978826-138978848 ACTTGAGGGTGGAGGGTAGAAGG + Intergenic
962860974 3:139401181-139401203 ACGTGAGGATGGAGGGTGGGAGG - Intergenic
963411170 3:144930061-144930083 ACTTGAGGATGGAGGGTAGGAGG + Intergenic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
964192371 3:154018223-154018245 CTGTGAGGATGGAGGGGCTGTGG + Intergenic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
967812994 3:193775989-193776011 CTGGGAGGATCCAGGGTTGATGG + Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
969299088 4:6287019-6287041 TTGTCAGGATGGAGGGGACAAGG - Intronic
969350724 4:6596603-6596625 CAGGGAGGATGGATGGTAGGAGG - Intronic
970125079 4:12800010-12800032 CTATGAGGTTGGAGGGTGGGAGG + Intergenic
971958940 4:33459325-33459347 ATTTGAGGGTGGAGAGTAGAGGG + Intergenic
972097539 4:35366998-35367020 ATTTGAGGATGGAGGATAGGAGG - Intergenic
972241558 4:37198810-37198832 ACTGGAGGATGGAGGGTAGAAGG - Intergenic
973840673 4:54857231-54857253 ATATAAGGTTGGAGGGTAGATGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974623752 4:64395820-64395842 ACTTGAGGGTGGAGGGTAGAAGG - Intronic
975390406 4:73810282-73810304 TTGTGAGAATGGAGGTTATAGGG + Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975802915 4:78081114-78081136 CTGTGAGGATGGGGGTTTGTGGG + Intronic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977845896 4:101766470-101766492 CAGAGAGGATTGAGGGGAGATGG - Intronic
977948698 4:102944223-102944245 ATTTGAGGGTGGAGGGTGGAAGG + Intronic
978147997 4:105399707-105399729 CTGTTAGGAGGCAGGGGAGAGGG + Intronic
978265664 4:106821490-106821512 CAGCCAGGATGGAGGGGAGATGG + Intergenic
978949484 4:114540446-114540468 CCTTGAGGGTGGAGGGTAGGAGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
980845003 4:138313599-138313621 GTTTGAGCATGGAGGGTTGAAGG - Intergenic
981682316 4:147413780-147413802 CTTGGAGGGTGGAGGGTAGGAGG - Intergenic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982816632 4:159893933-159893955 CGGTGAGGTTGGAGGGCAAAAGG + Intergenic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
984305242 4:177980998-177981020 ATATGAGGATGGAGGGTGGGAGG - Intronic
984706404 4:182850278-182850300 ATGTGAAGATGGAGGATCGAGGG + Intergenic
984801364 4:183720004-183720026 TAGGGAGGATGGATGGTAGAGGG - Intergenic
985549510 5:525843-525865 CTGAGCGGATGGATGATAGATGG + Intergenic
986264534 5:6180965-6180987 CTCTCAGGATGGAGGGGAGGAGG - Intergenic
986264598 5:6181209-6181231 CCCTCAGGATGGAGGGGAGAAGG - Intergenic
986353147 5:6898924-6898946 AGTTGAGGGTGGAGGGTAGAAGG + Intergenic
986597217 5:9436507-9436529 CTATGAGGAAGGAGGCTAAATGG - Intronic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986913543 5:12587497-12587519 GTGTCAGGACTGAGGGTAGAAGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987502205 5:18727469-18727491 TTCAGAGGATGGAGGGTGGAAGG - Intergenic
987520839 5:18981400-18981422 ACTTGAGGATGGAGGGTAGTGGG - Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
990871351 5:60433916-60433938 ATTTGAGGGTGGAGGGTAGGAGG + Intronic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992230617 5:74659920-74659942 CCTTGAGGATGAAGGGCAGAAGG + Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
993071117 5:83165630-83165652 GTTGGAGGATGGAAGGTAGACGG - Intronic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993970830 5:94418442-94418464 TTGGGAGGATGGAGGGGTGAGGG - Intronic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995672246 5:114619174-114619196 ATATGAGGATGGAGGGTGGGAGG + Intergenic
996180582 5:120414362-120414384 ACTTGAGGGTGGAGGGTAGAAGG + Intergenic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998128521 5:139639525-139639547 CTGGGAGTATGGAAGGTAGCAGG - Intergenic
998131019 5:139651073-139651095 CTGCGAGGATGAGGGGTAGGGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1003803852 6:9702948-9702970 GTGGGAGGATGGAGGATGGAAGG - Intronic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005902522 6:30229587-30229609 ATTTGAGGATGGAGGGTGGAAGG - Intergenic
1006027100 6:31154158-31154180 CAGTGAGGAAGGTGGGTATAAGG - Intronic
1006303497 6:33206352-33206374 CTATGAGAATGGTGGGGAGAGGG - Intronic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006839920 6:37022174-37022196 CTGGGAGGATGGGCGGAAGAAGG + Intronic
1006948383 6:37800837-37800859 CAGGGAGGATGGAGGGGTGACGG + Intergenic
1008081078 6:47195129-47195151 CTTTGAGGATGGAAAGTTGATGG - Intergenic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1010256774 6:73767202-73767224 ATGGGAGGGTGGAGGGTAGGAGG - Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012563251 6:100613811-100613833 CTATGAGGATGCAGGGGAAAGGG - Intronic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1012794998 6:103748697-103748719 GTGGGAAGATGGAGGGTAGGAGG - Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012830499 6:104198725-104198747 ACTTGAGGATGGAGGGTGGAAGG + Intergenic
1013140539 6:107329457-107329479 CTGTGAGGCTGGCCTGTAGATGG + Intronic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013612972 6:111812261-111812283 CTGGGAGGAGGCAGGGCAGATGG + Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013981205 6:116131820-116131842 TTCAGAGGGTGGAGGGTAGAAGG - Intronic
1017095322 6:150799742-150799764 CTGTGAGGAAGGAAGTTAAATGG - Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018185896 6:161265025-161265047 CTGTGGGGATGGATGCTAGGAGG + Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1018964476 6:168473841-168473863 GTGTGAGGAAGGAGGGCAGGGGG + Intronic
1019362561 7:612476-612498 ATGTAAGGATGGATGATAGATGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1021433929 7:20592891-20592913 ATGGGAGGATAGAGGGTGGAAGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021963645 7:25896044-25896066 TTGGCAGGCTGGAGGGTAGAGGG - Intergenic
1023328914 7:39091974-39091996 ATGTGAAGAGGAAGGGTAGAAGG + Intronic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024624547 7:51194099-51194121 CTCAGAGGATGGAGGGTGGGAGG - Intronic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026602923 7:71791546-71791568 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027956357 7:84883562-84883584 ATCTGAGGGTGGAGGGTAGAAGG - Intergenic
1028422787 7:90652012-90652034 CTGTGAGGATGGAGGCCACTGGG - Intronic
1028640375 7:93035740-93035762 ACTTGAGGGTGGAGGGTAGAGGG + Intergenic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029873640 7:103723521-103723543 CTGGTAGGATGGAAGGGAGATGG - Intronic
1031002827 7:116437194-116437216 GTTTGAGGGTGGAGGGTGGAAGG + Intronic
1031188605 7:118516729-118516751 CTGTGAGAAAAGAGGGTACAAGG - Intergenic
1031316856 7:120269360-120269382 ACTTGAGGGTGGAGGGTAGAAGG + Intergenic
1032350973 7:131163361-131163383 CACTGAGGATCGAAGGTAGAAGG + Intronic
1033299360 7:140173390-140173412 CTGTCAGGCTGCAGGGTGGATGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033921017 7:146391833-146391855 TTTGGAGGATAGAGGGTAGAAGG + Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034409636 7:150933321-150933343 CTGAGCGGAGGCAGGGTAGAGGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035460517 7:159035766-159035788 CTGTGAGGTTGGAGTGTTGGAGG - Intronic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037112088 8:15175531-15175553 GTTGGAGGATGGAGGGTAGGAGG + Intronic
1037427281 8:18770111-18770133 CTGTGAGGTTGGAGGGAAACTGG - Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1038761037 8:30384470-30384492 CGGAGAGGAGGGAGGGGAGAGGG + Intronic
1039674155 8:39641484-39641506 ATCAGAGGATGGAGGGTAGGAGG - Intronic
1039978017 8:42383597-42383619 CTTTGAGGAAGGAGGGTCCAGGG - Intergenic
1040804024 8:51374332-51374354 TTGAGAGGATGAAGGCTAGATGG - Intronic
1041916139 8:63141031-63141053 TTGGGAGGGTGGAGGGTGGAAGG + Intergenic
1042856189 8:73270540-73270562 CTTTCAGGAAGGAGGGGAGATGG + Intergenic
1044237096 8:89843545-89843567 CTTTGAGGTTGGAGGGTGGGAGG - Intergenic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1044729736 8:95220277-95220299 CCTTGAGGATGGAGGCTGGATGG - Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045610104 8:103829701-103829723 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1045909239 8:107386237-107386259 ATTTGAGGATGGAGGGTAGGAGG + Intronic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1047580409 8:126208251-126208273 ATTTGAGGATGGAGGGTGGGAGG - Intergenic
1047706409 8:127504111-127504133 CTTTGATGATTTAGGGTAGACGG - Intergenic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1048222043 8:132551107-132551129 CAGTGAGCATGGAGGTTACATGG - Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048569579 8:135640442-135640464 CTCTGTAGATGTAGGGTAGAAGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1048989290 8:139751931-139751953 CTGGATGGATGGTGGGTAGATGG - Intronic
1049048747 8:140174217-140174239 CTTGGAGGATGGAGGGTGGGAGG + Intronic
1049072354 8:140365917-140365939 TTTGGAGGGTGGAGGGTAGAAGG - Intronic
1049377960 8:142298042-142298064 CTGTGCGGACGGGGGGTAGCAGG - Intronic
1050003568 9:1103785-1103807 ATGGGAGGATGGAGGGTGGGAGG - Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052154980 9:25175380-25175402 CTGTGTGGATTGATGGTAGTAGG - Intergenic
1052635025 9:31092239-31092261 TTCAGAGAATGGAGGGTAGAAGG - Intergenic
1052878451 9:33584889-33584911 GTGTGAGGGTGGTGGGTAGTAGG + Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053497530 9:38559320-38559342 GTGTGAGGGTGGTGGGTAGTAGG - Intronic
1054138671 9:61456131-61456153 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1054824459 9:69558727-69558749 CTGTGAGGGTGGAGGATGGGAGG - Intronic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1056776541 9:89516983-89517005 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057568703 9:96187041-96187063 AAGAGAGGATGGAGGGGAGAGGG - Intergenic
1057677005 9:97143802-97143824 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059521997 9:114951471-114951493 CTGTGAGTATGGAGGGTTTTAGG + Intergenic
1060046676 9:120347020-120347042 ATGGGAGGGTGGAGGGTAGGAGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1061244866 9:129396370-129396392 ATGAGAGGATGGATGGTAGATGG + Intergenic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1061905536 9:133694783-133694805 CTTTGTGGATGGAGGATGGATGG + Intronic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1062147383 9:134997182-134997204 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062147392 9:134997219-134997241 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062289825 9:135789503-135789525 CTGTGAGGAAGGCGTGAAGAGGG - Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186653249 X:11584926-11584948 TTCTGAGGGTGGAGGGTGGAGGG - Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186753039 X:12641389-12641411 CTGAGAGCATGGAGGGGAGGGGG - Intronic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1188414043 X:29910217-29910239 ACTTGAGGGTGGAGGGTAGAGGG + Intronic
1188644865 X:32553405-32553427 ATGTGAGGCTGGAGGGTAAGAGG + Intronic
1188780499 X:34278200-34278222 CTTAGAGGATGGAGGCTACAAGG - Intergenic
1188817735 X:34736169-34736191 ATCAGAGGATGGAGGGTAGGAGG - Intergenic
1190908243 X:54749326-54749348 CTGTGAGCGTGGAGGGTTGGGGG + Exonic
1192138775 X:68630490-68630512 CTCTGAGGATGGGGGGTACCTGG + Intergenic
1192147009 X:68688803-68688825 CTCTGAGGATGGGGGGTACCTGG - Intronic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1193062378 X:77220338-77220360 CAGTGAGGATGGATGGTTCAGGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193966445 X:87992787-87992809 CTGGGAGGATGTAGGGAAAAGGG - Intergenic
1194322681 X:92471256-92471278 CTTGGAGGATGGAGGGTGGGAGG - Intronic
1194647477 X:96475051-96475073 TTGCCAGGATGTAGGGTAGAAGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197077556 X:122371402-122371424 CTGGGAAGGTGGAGGGTTGAGGG - Intergenic
1197907823 X:131445092-131445114 ATAGGAGGGTGGAGGGTAGATGG + Intergenic
1198152211 X:133922380-133922402 CTCTGAGAATGGAGGATGGAGGG + Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198723078 X:139645433-139645455 ATGTGAGGAGGGAAAGTAGAAGG - Intronic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1198796528 X:140402510-140402532 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1199223581 X:145344886-145344908 ATTGGAGGATGGAGGGTAGAAGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1199785797 X:151103766-151103788 CTCTGAGGATGCAGTGTGGATGG + Intergenic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200630832 Y:5584734-5584756 CTTGGAGGATGGAGGGTGGGAGG - Intronic
1200945070 Y:8826804-8826826 CTGGGATGATAGAGGGGAGAGGG + Intergenic
1201184051 Y:11380660-11380682 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic