ID: 1012249855

View in Genome Browser
Species Human (GRCh38)
Location 6:96968196-96968218
Sequence CAGTGATTCTCAATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012249851_1012249855 3 Left 1012249851 6:96968170-96968192 CCCTATGTGAGTCTGTTGCTCTC 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1012249855 6:96968196-96968218 CAGTGATTCTCAATGGTGGATGG 0: 1
1: 0
2: 1
3: 35
4: 243
1012249852_1012249855 2 Left 1012249852 6:96968171-96968193 CCTATGTGAGTCTGTTGCTCTCA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1012249855 6:96968196-96968218 CAGTGATTCTCAATGGTGGATGG 0: 1
1: 0
2: 1
3: 35
4: 243
1012249850_1012249855 13 Left 1012249850 6:96968160-96968182 CCTCTGCACTCCCTATGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1012249855 6:96968196-96968218 CAGTGATTCTCAATGGTGGATGG 0: 1
1: 0
2: 1
3: 35
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012249855 Original CRISPR CAGTGATTCTCAATGGTGGA TGG Intronic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
902670528 1:17970170-17970192 CATTCATTCTTAATGGAGGAGGG + Intergenic
906881324 1:49594519-49594541 CAGGGACTGTCAGTGGTGGATGG - Intronic
906883120 1:49614391-49614413 CACTCATTCTCAATGCTGTATGG + Intronic
907181905 1:52578282-52578304 CCTTGATTCTTAATGGTGGATGG - Intergenic
908403971 1:63795617-63795639 GAGTGATTCTGAATGGTGGGAGG + Intronic
910345623 1:86233274-86233296 CAGTAATTTTCACTGATGGATGG + Intergenic
910997766 1:93127454-93127476 CAGTGATTCTCAAGGATTGGAGG + Intronic
911101062 1:94096149-94096171 CAGTGATTCTCAATCTTGGCCGG + Intronic
913201360 1:116497395-116497417 CACTGATTCCTAATGGTGGATGG + Intergenic
914335568 1:146712072-146712094 CAGTGGTTCTCAGTGTTGGCTGG - Intergenic
915019943 1:152769673-152769695 CAGTGGTTCTCAATGGGGTGAGG - Intronic
915676563 1:157537620-157537642 TAGTGATTTTCAAAAGTGGAGGG - Intronic
916626884 1:166567686-166567708 TAGTGATTTTCAATAGGGGAGGG + Intergenic
918553628 1:185773121-185773143 CAGTGATTCTCCATTGGGAATGG + Intronic
918838076 1:189495836-189495858 AATTGATATTCAATGGTGGAGGG + Intergenic
922311211 1:224392849-224392871 AAGTGATTCTCTGTGGAGGAGGG - Intronic
923403467 1:233637867-233637889 CAGTGATTCTCAATGGGTTGTGG + Intronic
924567304 1:245209630-245209652 GAGAGATTCTCATCGGTGGACGG + Intronic
1063550548 10:7028865-7028887 CTGTAATTCCCAATGTTGGAGGG - Intergenic
1063994231 10:11602567-11602589 CCGTGAATCTCAATGAAGGAAGG - Intronic
1065170546 10:23022903-23022925 CAGTGTTTCTCAGTGGGAGAGGG - Intronic
1066430719 10:35348788-35348810 CAGTGATTCTCAGTCAGGGATGG + Intronic
1069020896 10:63487325-63487347 CAGTGATTCTCAACACAGGAGGG + Intergenic
1069896136 10:71681333-71681355 CATTGATTCTCAACTGGGGAGGG - Intronic
1070112677 10:73500054-73500076 CAGTGGTTCTCAATGGATAAAGG - Intronic
1071439655 10:85679111-85679133 CAGTAATTCTCAGTGGTGGTGGG + Intronic
1074266237 10:111906375-111906397 ATGTGATCCTCAATGTTGGAGGG + Intergenic
1074849557 10:117428279-117428301 TAGTGATTCTCATTGGAGAATGG + Intergenic
1075349489 10:121710927-121710949 AAGTGATTTTCAAAGTTGGAGGG + Intergenic
1076481520 10:130788169-130788191 CAGGGATTCTCCAGGTTGGAGGG + Intergenic
1076556090 10:131322317-131322339 CAGTGATTCTCAGGGTAGGATGG - Intergenic
1076584435 10:131535599-131535621 CACTAATTCTCAGAGGTGGATGG + Intergenic
1076890342 10:133280325-133280347 CAGTGGTTCTCAATGCAGGGTGG + Intronic
1077187677 11:1242772-1242794 CTGTGCTTCTCAGTGCTGGAAGG - Exonic
1077188100 11:1244443-1244465 CTGTGCTTCTCAGTGCTGGAAGG - Exonic
1077188637 11:1246543-1246565 CTGTGCTTCTCAGTGCTGGAAGG - Exonic
1077189055 11:1248214-1248236 CTGTGCTTCTCAGTGCTGGAAGG - Exonic
1077189618 11:1250398-1250420 CTGTGCTTCTCAGTGCTGGAAGG - Exonic
1081410202 11:42748853-42748875 GGGTGATACTCAATGGTGGCTGG - Intergenic
1081539057 11:44016922-44016944 CAGAGATTCTCAGTGCTGGAGGG - Intergenic
1083376825 11:62230300-62230322 CAGGCATTGTTAATGGTGGAGGG - Intergenic
1085072925 11:73564407-73564429 CAGTGATTCTCAAGTGCAGATGG + Intronic
1085370065 11:75994055-75994077 ATGTGATCCTCAATGTTGGAGGG - Intronic
1086509278 11:87539131-87539153 CAGTGTTTCTCACTTGTGGGTGG + Intergenic
1087466421 11:98512341-98512363 CAGTCATTCTTATTGGTGTAAGG + Intergenic
1089290798 11:117437101-117437123 CAGTGAGTCGCAAGGGTGGAAGG - Exonic
1090357354 11:126148901-126148923 CAGTGGTTCTCAATTCTGGTGGG - Intergenic
1091453270 12:586854-586876 CAGTGATTCTCATGGGAGCAGGG - Intronic
1093342477 12:17995648-17995670 CACTAATTCTCATTGTTGGAGGG - Intergenic
1093502738 12:19830842-19830864 CCTTGATTCTCAATGATAGAGGG + Intergenic
1093503860 12:19841929-19841951 CAGTGGTTCTCAAAAGGGGATGG - Intergenic
1096683832 12:53274755-53274777 CAGTGAGTGTGTATGGTGGAAGG - Intronic
1096761422 12:53844958-53844980 CAGTCATTCTCAATGCTGATGGG + Intergenic
1096980769 12:55727381-55727403 CAGTGGCCCTCCATGGTGGAGGG + Intronic
1097239258 12:57563745-57563767 CAGGGAATCTCAGTGGGGGAAGG + Intronic
1099257825 12:80336621-80336643 CAGGGATTCTCACAGGAGGAGGG + Intronic
1101723903 12:107374036-107374058 CACTGAGTCTCCATGGTGGGAGG + Intronic
1103038671 12:117676901-117676923 CAGTGACCATCAATAGTGGAAGG + Intronic
1103232581 12:119344264-119344286 TGGTGATTCTCAACTGTGGATGG - Intronic
1103526027 12:121569174-121569196 CAGTGATTCTCCAGGGTTGCTGG - Intronic
1105001416 12:132691708-132691730 CAGGGATTCTCAGTGGGGAAGGG - Intronic
1107079299 13:36357191-36357213 CAGTTTTTTTCAAGGGTGGATGG + Intronic
1107348095 13:39484760-39484782 CAGTGATTCTCACTTGCGGAGGG + Intronic
1108728633 13:53208562-53208584 CAAGAATTCTCAATGGTAGAAGG + Intergenic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109912709 13:68936490-68936512 CACTGAGTCTAAATGGTGGAAGG + Intergenic
1110772134 13:79361875-79361897 CAGTGATTCTCAGTGGGGATGGG + Intronic
1111051334 13:82885804-82885826 CTGTAATTCCCAATGTTGGAAGG - Intergenic
1113027875 13:105960974-105960996 TAGTGATTCTCATTAGAGGATGG + Intergenic
1113411411 13:110093691-110093713 CAGTGACTCTCAATCCTGGTTGG + Intergenic
1113866465 13:113528967-113528989 CAGTTATTCTCAACGGAGGGCGG + Intronic
1113966990 13:114158339-114158361 CAATGATTTCCAAAGGTGGAAGG - Intergenic
1115791560 14:36884662-36884684 CAGTGATTCTCACAGGTGTGAGG + Intronic
1116713196 14:48396114-48396136 TGGTAATTCTCAATGTTGGAGGG + Intergenic
1117284057 14:54269089-54269111 CTGTGCTTGTCACTGGTGGATGG - Intergenic
1117615594 14:57530836-57530858 CACTGGTTCTCAATGTGGGAAGG - Intergenic
1117735847 14:58767598-58767620 CCTTGAATCTTAATGGTGGAAGG + Intergenic
1119393126 14:74304714-74304736 CAGTGGTTCTCAATGCTAGGGGG - Intronic
1119719265 14:76880197-76880219 CAGTGCTTCTCAGTGGAGGGTGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120959108 14:90108521-90108543 CAGTGATTCTCAAGGTGGGATGG - Intronic
1121517582 14:94563016-94563038 CAGTGATTTTGCATGGAGGATGG - Intronic
1122183198 14:99970883-99970905 TAGTGAATCTCACTGGTGGCTGG - Intergenic
1122230418 14:100304126-100304148 CAGTGCTTCTCCTTGGTGGCTGG - Intronic
1123974758 15:25542759-25542781 CACTGCTTCTCCATGGAGGAGGG - Intergenic
1124683615 15:31758965-31758987 CAGTGATTCTAAACCCTGGAGGG - Intronic
1125491896 15:40154794-40154816 CTGTGTTTCTCAAGGGTGGGAGG + Intergenic
1125563739 15:40659427-40659449 ACGTGATTCTGAATGGTGGAAGG - Exonic
1129884213 15:79027262-79027284 CAGTGGTTCTCATGGGTAGAAGG - Intronic
1130853555 15:87821149-87821171 CTGTGATTCTCAATGATACAGGG - Intergenic
1131457955 15:92597944-92597966 CTTTTATTCTCAATGGTGCAAGG + Intergenic
1133882694 16:9797929-9797951 CAGTGGTTCTCAAAGGGTGAAGG - Intronic
1133985056 16:10662104-10662126 GGGTGATTCTCCATGGTGGGGGG + Intronic
1134577320 16:15343420-15343442 TAGAGATTCTCAATCGTGAATGG - Intergenic
1136998581 16:35208311-35208333 CACTGGTTCCCAACGGTGGATGG + Intergenic
1138631685 16:58300173-58300195 CAGTGATGCTCAAAGCTGAAGGG + Intronic
1139302143 16:65954475-65954497 CAGTGGTTCTCAACCTTGGATGG + Intergenic
1139998059 16:70999156-70999178 CAGTGGTTCTCAGTGTTGGCTGG + Intronic
1141418126 16:83892831-83892853 CAGTGATTCTCAATAGCAGGAGG + Intergenic
1141823813 16:86465316-86465338 AAGTCATTCTCAAAGGAGGAGGG + Intergenic
1141833999 16:86526393-86526415 CAGTGATTTCAAATGGGGGAAGG - Intergenic
1143561482 17:7698286-7698308 CAGTGATTCTAAATAGAAGAAGG + Intronic
1144236732 17:13268823-13268845 CAGTGGTTCTCAAAGTTGGCTGG - Intergenic
1144934005 17:18883127-18883149 CAGTGGTTCCCTAGGGTGGAAGG - Intronic
1147464011 17:40596682-40596704 GAGTGCTTCTGATTGGTGGAGGG + Intergenic
1147464027 17:40596829-40596851 GAGTGCTTCTGATTGGTGGAGGG + Intergenic
1148663824 17:49360557-49360579 CTGTGATTGTCAGTGGTGGCAGG - Intronic
1148979726 17:51562139-51562161 CAGTAGTTCTCAGTGGGGGAAGG + Intergenic
1150471382 17:65440200-65440222 CAATGGTTCTCAAAGGAGGAGGG - Intergenic
1150711212 17:67532277-67532299 CAATGGTTCTCAAAGGTGGCTGG - Intronic
1150917584 17:69452102-69452124 CAGTGCTTCTCAACGGAGGGTGG + Intronic
1151214218 17:72566530-72566552 CAATGAGTCTCAAGGGTGGCCGG - Intergenic
1151474605 17:74338566-74338588 CTGGGATTCTCAGTGGAGGAGGG - Intronic
1152057309 17:78039982-78040004 CAGTTATTGCCAATGGTGGAAGG + Intronic
1152422760 17:80202958-80202980 CAGTGGTTTTCAATGGAGCAAGG - Intronic
1154301204 18:13194269-13194291 CAGTGATTCCTAATGGGGCAAGG + Intergenic
1155176063 18:23302343-23302365 CAGTGATTCTCAACTGGGGTGGG + Intronic
1155456455 18:26020372-26020394 CAGTGACTCTCAATGATGGAGGG + Intronic
1156233938 18:35183164-35183186 TAGTGGTTCTCAATGGTAGGAGG - Intergenic
1156437648 18:37150426-37150448 CAGTGGTTCTCAAGTGTGGTAGG - Intronic
1156536753 18:37871827-37871849 CAGTGATGCTCAATGGAAGGAGG - Intergenic
1157683624 18:49626161-49626183 CAGTGATTCTCAAAACTGGCAGG - Intergenic
1157904015 18:51550236-51550258 CAGTGAAGGTCAATGGTGAAAGG - Intergenic
1158086204 18:53654494-53654516 CAGTGGAGCTGAATGGTGGAGGG - Intergenic
1159975796 18:74710855-74710877 CAGTGAATCTGAATGGAGAATGG + Intronic
1160556580 18:79729471-79729493 CAGCGTTTCTCAATGGGGGCCGG - Intronic
1160924779 19:1538723-1538745 TAGTTGTTCTCAATGGTGGGGGG + Intergenic
1161482944 19:4519746-4519768 CAGTGCTTCCCAAGGGTGGCTGG + Intergenic
1164800903 19:31075847-31075869 CAGACATTCTCACTGGAGGACGG - Intergenic
1166169209 19:41015609-41015631 CACTGATTCTCAGAGGTGCAAGG - Intronic
925835565 2:7942819-7942841 CAGTGCTTCTGAATGGTAGAAGG + Intergenic
931180466 2:59895077-59895099 CAGAGATAATCAATGATGGATGG + Intergenic
931629927 2:64289687-64289709 CAGTGATTCTCAATCCTGGCTGG - Intergenic
932400592 2:71478642-71478664 CAGTGATTCACAGTGGGAGAGGG + Intronic
933616809 2:84490480-84490502 CAGTGATTACCAATGGTTGGAGG - Intergenic
933704571 2:85280140-85280162 CAGTGATTCTCAGTTGCGGGAGG + Intronic
935801380 2:106700214-106700236 CAGTCATTCTCCAAGGTGGGAGG - Intergenic
935808897 2:106775872-106775894 CATTGATTCTCAATTGTCTATGG - Intergenic
936340956 2:111632393-111632415 GGCTGATTCTCAATGATGGAAGG - Intergenic
936845306 2:116823879-116823901 CAATGATTGTCAATGTTGCAGGG + Intergenic
943211530 2:184973642-184973664 TAGTGACTCTCAATGTTGGCAGG - Intergenic
944591572 2:201222654-201222676 CAGGGATTCACAATGGTGTTGGG + Intronic
944867255 2:203874757-203874779 CAGTGATTCTCAAAACTTGATGG - Intergenic
945005856 2:205405185-205405207 CAGTGGTTCTCAATGGGAGGGGG + Intronic
945386069 2:209202672-209202694 CAGTGATTTTCAAAAGGGGAGGG + Intergenic
946935336 2:224714430-224714452 CGGTGGTTTTCAATGGTGGATGG + Intergenic
947205927 2:227661167-227661189 CCGTGATGCTCAGTGGAGGAGGG - Intergenic
948545227 2:238723352-238723374 CAGTGGTCTTCAATGCTGGAGGG - Intergenic
948616513 2:239202671-239202693 CGGTGATTCTCCATGTTGCATGG - Intronic
1170048475 20:12113255-12113277 CAGTGATTCTCATTCCTGGCTGG + Intergenic
1170490091 20:16863808-16863830 CAGTGATGCTCACTGATGGTGGG + Intergenic
1172804549 20:37602309-37602331 CAGTGATTCTCAAGGCAGGATGG + Intergenic
1173425320 20:42937759-42937781 CAGTGATTATGGATGGTGAATGG - Intronic
1173572301 20:44085315-44085337 CAGTGGTTCTCAATCCAGGATGG - Intergenic
1179167774 21:38948005-38948027 CAGTGAGTCTCATTGAGGGAGGG - Intergenic
1179216436 21:39371045-39371067 CAGTGATTGACACTGGTGTATGG + Intergenic
1179768698 21:43596478-43596500 TTGTGATTCTTATTGGTGGAGGG - Intronic
1180188930 21:46153634-46153656 CAGTGATCCTGAGGGGTGGATGG - Intronic
949930088 3:9071625-9071647 GACTGATTCTCAAAGGTGGATGG + Intronic
950049274 3:9974415-9974437 CTATGATTCTTATTGGTGGATGG - Exonic
950590353 3:13932431-13932453 CAGTGGTTCTCAAACCTGGAGGG + Intergenic
952095324 3:29944336-29944358 CAGTGATTCTCAACAGAGGTGGG + Intronic
952212856 3:31246992-31247014 CAGGGATTCTCAAAGGGAGAGGG + Intergenic
954233575 3:49238093-49238115 CAGTGTTTCTCCATGTTGGCGGG + Intronic
955595170 3:60582061-60582083 CAGTGATTCTCAACCTTGGCTGG + Intronic
959171687 3:102851993-102852015 CTGTAATCCTCAATGTTGGAGGG + Intergenic
961249423 3:125487797-125487819 CAGTGATTCCCAGGGGTTGAGGG + Intronic
962314610 3:134351233-134351255 CAGTGAATGGCAATGGGGGATGG + Intergenic
963102533 3:141620826-141620848 CAGTGATTCTCAACCAGGGATGG + Intergenic
963574494 3:147042853-147042875 CAGTGGTTCTCAATAGGGGTAGG - Intergenic
963878673 3:150503935-150503957 CAGTGACTGTGAAGGGTGGATGG - Intergenic
965418656 3:168428601-168428623 CAGTGGTTCTCAATTTCGGAAGG - Intergenic
966102847 3:176294439-176294461 GAGTAATCCTCAATGGAGGAGGG - Intergenic
968854030 4:3105067-3105089 CAGTAATTCACAATGTTAGAAGG + Intronic
970663165 4:18308623-18308645 CAGTGAGTCTCAAGGGATGATGG + Intergenic
971063875 4:23005101-23005123 CTGTCATTCTCAATGCTGAAGGG - Intergenic
972259344 4:37392564-37392586 CAGTGATTCTCAATAGAGGTTGG - Intronic
974017346 4:56659617-56659639 CAGTGCTTCTCAAGCCTGGATGG + Intronic
975727322 4:77304694-77304716 CAGTGATTCTGAGTGATGAAGGG + Intronic
976133556 4:81910748-81910770 CAGTGGTTCTCAGTGGTAGGGGG + Intronic
976294723 4:83458687-83458709 CAGTAATTCTCAATTGGTGAGGG + Intronic
977560010 4:98522759-98522781 CAGTGACTCACAAAGGAGGAAGG + Intronic
978456177 4:108894885-108894907 CAGTGATACTCAACTGTGGGTGG + Intronic
979688068 4:123532772-123532794 CAGTGCTTTTCATTGCTGGAAGG - Intergenic
979702942 4:123688587-123688609 CTGTGATTCCCAGTGTTGGAGGG - Intergenic
981227637 4:142315364-142315386 AAGTAATTCTCAATTGTGGGAGG + Intronic
981672927 4:147308407-147308429 GAGTGATTCTCATTTGTGGATGG - Intergenic
981735833 4:147949409-147949431 CAGTGTTTCTCAACTGAGGATGG + Intronic
984215146 4:176902594-176902616 CAGTGTTTCTCATTGGTAAAAGG + Intergenic
984494086 4:180472750-180472772 CAGTGATTATCCATCATGGATGG - Intergenic
984885960 4:184449543-184449565 CAGTGATACGCAATGACGGAAGG + Intronic
986378114 5:7153726-7153748 TAGTCATTCTGACTGGTGGAAGG + Intergenic
986597196 5:9436311-9436333 CTGTGGTTCTCCATGGGGGAGGG + Intronic
988084390 5:26456715-26456737 CATTGATTCCCATTGGTGAAGGG - Intergenic
989090297 5:37723578-37723600 CAGCGATTATCATTAGTGGATGG + Intronic
989375595 5:40756710-40756732 CAGTGGTTCTCAACGGGGCAGGG - Intergenic
991315872 5:65305695-65305717 TAATGATTCTCATTTGTGGAGGG + Intronic
992270124 5:75054576-75054598 CAGTGAATCTCAAAGAGGGAGGG + Intergenic
993988933 5:94632386-94632408 CAGTGATTCTAAAATGTGTACGG - Intronic
993993153 5:94685079-94685101 CTCTGATTTTCAATAGTGGATGG - Intronic
994091601 5:95814425-95814447 CAGTGATTTTCAAGGTGGGATGG + Exonic
994122928 5:96136743-96136765 CAGTTTTTCTCATTGTTGGAGGG - Intergenic
994726083 5:103437294-103437316 GAGTGATTCTTAGTGGAGGATGG + Intergenic
997448112 5:133957712-133957734 CACTGATTCTCAAAGCAGGAAGG + Intronic
1000479217 5:161750903-161750925 CAGTGATTTTCAAGGTGGGATGG + Intergenic
1001454540 5:171850656-171850678 CAGTGGTTCTCAATGGGAGAGGG + Intergenic
1001507933 5:172295199-172295221 CAGACATCCTAAATGGTGGATGG - Intergenic
1002152112 5:177242717-177242739 CAGGGTTTCTCAATGGTAGTCGG + Intronic
1005006092 6:21289125-21289147 CAGTGATTCTCAAGGGGGAGGGG - Intergenic
1006357428 6:33568165-33568187 CAGTGCCTCCCACTGGTGGAGGG + Intergenic
1007957053 6:45927557-45927579 CAGTGGTTCTCCCTGGTAGAAGG - Intronic
1008373041 6:50758241-50758263 CATTGATTCTCAGTGTTGGAAGG + Intronic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009874470 6:69488639-69488661 CAGGGATTCTTAATTTTGGAGGG - Intergenic
1012249855 6:96968196-96968218 CAGTGATTCTCAATGGTGGATGG + Intronic
1012438170 6:99236952-99236974 CTGTGATACTCAATCGTGGAAGG - Intergenic
1012499000 6:99868206-99868228 CCGTCATTCTCAATTGTGGCAGG + Intergenic
1012502597 6:99905983-99906005 TGGGGATTCTCAATGCTGGATGG - Intergenic
1012526247 6:100181521-100181543 CAGTGATTGCCAAGGGTTGAAGG - Intergenic
1016606991 6:145940986-145941008 CAGTGGTTCTCATTAGTGGGAGG + Intronic
1017715057 6:157204096-157204118 CAGTGATTAACAGTGTTGGACGG - Intronic
1019619951 7:1987076-1987098 CACTGGATCTAAATGGTGGATGG - Intronic
1019900155 7:4014055-4014077 CAATTATTCTCATTAGTGGATGG - Intronic
1020467074 7:8492738-8492760 CAGTGGGTCCCATTGGTGGAGGG + Intronic
1021344362 7:19506772-19506794 CAGTGTTTCTTAATGGTGAAGGG + Intergenic
1021348492 7:19557897-19557919 CAATGATTCCCAATGATGGGAGG - Intergenic
1022253281 7:28629940-28629962 CATGGACTCTCAATGTTGGAAGG + Intronic
1022861300 7:34369717-34369739 CAGTGATTATCAATGGGAGATGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1026248112 7:68641242-68641264 CAGTGCTTCTCCATGGTGGTAGG - Intergenic
1026317328 7:69238591-69238613 CAGTGTTTCACCATGGTGGCCGG + Intergenic
1027702742 7:81488180-81488202 AATTTATTTTCAATGGTGGAGGG - Intergenic
1027902754 7:84138270-84138292 CAGTAATTTTGTATGGTGGAGGG + Intronic
1028096827 7:86771027-86771049 CAGTGATTCTCAGTGAGGAAAGG - Intronic
1029848835 7:103442029-103442051 CAGTGATTCTCAATCCTGACTGG + Intronic
1030889885 7:114986465-114986487 CAGTGATTCACAAGGAAGGAGGG - Intronic
1030982210 7:116199705-116199727 CAGTGGTTCTCAACTGAGGATGG + Intergenic
1032433051 7:131878607-131878629 CAGTGGTTCTCAACAGGGGAAGG - Intergenic
1032798859 7:135302024-135302046 CTGTAATTCTCAACTGTGGATGG - Intergenic
1033655170 7:143368403-143368425 CATTGGTTCTCCATGGAGGAAGG - Intergenic
1034988244 7:155530923-155530945 CAGTGGTTCTCAACTGGGGATGG - Intronic
1037361108 8:18074888-18074910 CTGTGATTCTCTATGGTGCCTGG - Intronic
1039379989 8:37076194-37076216 CTTTGAATCTCAAGGGTGGAGGG - Intergenic
1040949596 8:52924027-52924049 CAGTGATTCCCAAAGTTTGAGGG - Intergenic
1043224939 8:77714339-77714361 CAGTCATTCTGACTGGTGTAAGG + Intergenic
1043400999 8:79884203-79884225 CAGTGTTTCTCCATGTTGGTCGG + Intergenic
1044540375 8:93402303-93402325 CTCTGATTCTCATAGGTGGAAGG + Intergenic
1045365622 8:101473166-101473188 CATTGTTTCTCAATGCTGGTTGG + Intergenic
1048036298 8:130680514-130680536 CAGTTATTCTCAAAGGGGGATGG - Intergenic
1048610942 8:136022472-136022494 CAGTGATTCTCAACGCGGAAAGG + Intergenic
1051625468 9:19095409-19095431 CAGTGATACTCCATGGTTGACGG + Intronic
1051895061 9:21977668-21977690 CAGTGGTTCTTAATGGGGGTGGG + Intronic
1052741066 9:32393611-32393633 CAGTGATTTTCAAAAGGGGAGGG - Intronic
1053342963 9:37354177-37354199 TAGTGATTCTTAACGGTGGGGGG - Intronic
1053421988 9:37985526-37985548 CAGTGAGTCTCCACGGGGGATGG - Intronic
1053430015 9:38035930-38035952 GAGTGATTCTCAGTCTTGGATGG - Intronic
1054712836 9:68528833-68528855 CAATGATTTTCAGTGGTGCATGG - Intronic
1055800884 9:80034149-80034171 AGGTGATTCCCAATGCTGGAAGG - Intergenic
1056265539 9:84893193-84893215 CAGTGATTGCCTCTGGTGGAGGG - Intronic
1057417288 9:94876290-94876312 CAGGCATCCTCAATGGTGGATGG - Intronic
1057974629 9:99591854-99591876 AAGTGCTTTTCTATGGTGGAAGG - Intergenic
1058758463 9:108105670-108105692 CAGTGGTTCTCAATTTTGGATGG + Intergenic
1058778840 9:108312596-108312618 CAGTGATTCTCAACAGAGGGAGG - Intergenic
1059179022 9:112194326-112194348 CAGTGATTCTCAACCAGGGAAGG + Intergenic
1061028447 9:128065677-128065699 CAGTGATTCTCAGTGGGGGTTGG - Intronic
1186818155 X:13258398-13258420 CAGTGACTCTCAATGTGGGAAGG - Intergenic
1187581020 X:20607417-20607439 CAGTGCTTCTCAAATGTGGAAGG + Intergenic
1187592341 X:20732058-20732080 CCCTGATTCTTAATGATGGAAGG + Intergenic
1188165816 X:26862315-26862337 CAGTGATTCTAAGAGGTTGAGGG - Intergenic
1188302670 X:28524912-28524934 TAGTGATTCTCAAACATGGATGG + Intergenic
1188673216 X:32905920-32905942 CAGTGATTCTCAACTCTGGGTGG - Intronic
1189350369 X:40271262-40271284 CAGTGATTCTCAAACTTGAATGG - Intergenic
1192458631 X:71298840-71298862 CAGTAATTCTAAATGGTGGTAGG + Intronic
1194675002 X:96783740-96783762 GAGTGATTCCCAAAGGAGGAAGG - Intronic
1194988511 X:100518584-100518606 CAGTGATTCTGAGTGGTGTTTGG + Intergenic
1197047889 X:122022030-122022052 TAGTCATTCTGAATGGTAGAAGG + Intergenic
1198939794 X:141941065-141941087 CAGTGATTCTCAAAAGTGCATGG - Intergenic
1199165834 X:144673995-144674017 CAGTGATTATCTATGGGTGAAGG - Intergenic