ID: 1012253720

View in Genome Browser
Species Human (GRCh38)
Location 6:97008521-97008543
Sequence CAGCTCAGAGAGTTTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 8, 3: 32, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012253720_1012253726 15 Left 1012253720 6:97008521-97008543 CCCATGCCAAACTCTCTGAGCTG 0: 1
1: 0
2: 8
3: 32
4: 222
Right 1012253726 6:97008559-97008581 CCTGCTCCTGCCACCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012253720 Original CRISPR CAGCTCAGAGAGTTTGGCAT GGG (reversed) Intronic
900413632 1:2525215-2525237 CAGCTCAGAGGGAATGGCCTGGG + Intronic
901935195 1:12621810-12621832 CAGCTCAGGGACTTTGGGGTGGG + Intergenic
903865005 1:26391688-26391710 CAGCTCAGAGAGGATGCCCTGGG - Intergenic
904046292 1:27610899-27610921 CTGCTCAGAGGGGTTGTCATAGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
908829953 1:68168824-68168846 CAGGTCAGAGAGTTTTTTATTGG - Intronic
910367710 1:86484484-86484506 CAAGTCATAGAGTTTGCCATTGG + Intronic
911847419 1:102771975-102771997 CAGCTCTGAGAGTTCTGCATTGG - Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
916425357 1:164675001-164675023 CAACTCAAAGAGATTGGCAAGGG + Intronic
917343352 1:174003534-174003556 CAGGTCAGAGATGTTGGTATTGG - Intronic
919748990 1:201024871-201024893 CATGTCAGAGATTTTGGCAAGGG + Intergenic
921336599 1:214093112-214093134 AAGCCCAGAGGGTTTGTCATGGG + Intergenic
1062965704 10:1606286-1606308 CAGCTCAGAGAGTCTGGGCTGGG - Intronic
1066225892 10:33382950-33382972 TAGCTCAGAGAATTCGGCTTGGG - Intergenic
1069630629 10:69895146-69895168 CAGCTCAGAGAAGGTGGCTTGGG + Intronic
1070172200 10:73941222-73941244 CAGGTCAGAGAATTTGACTTCGG - Intergenic
1072789563 10:98308422-98308444 CAGCCCAGTGGGTTTTGCATAGG + Intergenic
1074162596 10:110846603-110846625 CAGCTCAGAGAGGTGGGAACTGG + Intergenic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1076558236 10:131344297-131344319 CAGCTCAGAGGGAGAGGCATCGG + Intergenic
1076558255 10:131344381-131344403 CAGCTCAGAGGGAGAGGCATCGG + Intergenic
1076558284 10:131344507-131344529 CAGCTCAGAGGGAGAGGCATCGG + Intergenic
1076558293 10:131344549-131344571 CAGCTCAGAGGGAGAGGCATCGG + Intergenic
1077841715 11:5982693-5982715 GAGCCCAGAGGGTTTGGCATGGG - Intergenic
1078001711 11:7501868-7501890 CAACTCACTGAGTTAGGCATTGG + Intronic
1078114059 11:8427157-8427179 GAGCTCAGAGGGTTTGCCACAGG - Intronic
1078453412 11:11457007-11457029 CAGCTCTGAGCGTTGTGCATGGG + Intronic
1080422777 11:32126627-32126649 GAGCCCAGCGAGTTTGGCATGGG + Intergenic
1081776738 11:45680981-45681003 GAGGTCAGACAGTTTGGCCTTGG - Intergenic
1081813638 11:45926888-45926910 CAGCCCAGGGGGTATGGCATGGG + Intronic
1084106991 11:66986663-66986685 GAGGACAGAGAGTTTGGCAAGGG + Intergenic
1084773360 11:71358432-71358454 AGGCTCAGAGAGGTTGACATCGG + Intergenic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1089535138 11:119156421-119156443 CATCTCAAAGAGCTTGGCACTGG - Exonic
1089787456 11:120918228-120918250 AAGCTCAGAGACTTAGGCTTGGG - Intronic
1090607399 11:128435574-128435596 CCACTCAGAGAATTTGGAATTGG + Intergenic
1090920674 11:131203624-131203646 CAGCTCTGAGAAGTTGCCATGGG - Intergenic
1092095874 12:5841587-5841609 CAGCTCAGAGAGAGGGGCAGGGG - Intronic
1093102005 12:15038660-15038682 GAGCTCAGAGGGTTTGGTGTGGG - Intergenic
1096609452 12:52791340-52791362 CAGCTCTTGGAGCTTGGCATTGG + Exonic
1096678569 12:53240043-53240065 CAGGTCAGAGAGTAAGGCAGAGG - Intergenic
1097303524 12:58043597-58043619 GAGCCCAGAGAGTTTGGCATAGG - Intergenic
1100998539 12:100330683-100330705 AAGTTGAGAGCGTTTGGCATTGG + Intronic
1101338526 12:103819567-103819589 CAGCTCAGAGTGGCTTGCATTGG - Intronic
1102586717 12:113928666-113928688 CAGCTCAGGGAGTTGGGAACAGG + Intronic
1107215753 13:37916671-37916693 CAGCTCATAGATTTTTGCTTTGG - Intergenic
1111876730 13:93906324-93906346 CTTCTCTGAGAGTTTGGAATTGG - Intronic
1114359830 14:21959247-21959269 AAGCCCAGAGTGTTTAGCATGGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1118114706 14:62762131-62762153 GAGCCCAGAGAGTTTGGCTTGGG + Intronic
1118909849 14:70052172-70052194 CAGCTCAGAGTATTAGGCATGGG + Intronic
1119916301 14:78405517-78405539 CATCTCAGAGTGTTTGTCACTGG + Intronic
1120412747 14:84177827-84177849 CAGCTCAAACAGTTATGCATAGG - Intergenic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1121479601 14:94253962-94253984 CAGCTCAGGGAGTGTGGCTCCGG - Intronic
1125239500 15:37558015-37558037 AAGCCCAGAGGATTTGGCATGGG + Intergenic
1125367400 15:38932658-38932680 GAACCCAGAGGGTTTGGCATGGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1128412172 15:67410672-67410694 CAACTCACATAGTTAGGCATGGG + Intronic
1128526910 15:68418774-68418796 GAGCTCAGACAGTTTGGTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129499806 15:76024718-76024740 AAGATGAGAGAGTTTGGCAGTGG - Intronic
1129582856 15:76831102-76831124 GAGCCCAGAGGGTTAGGCATGGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1130822437 15:87509603-87509625 CAGCAAAGAGATTCTGGCATGGG - Intergenic
1133144299 16:3772491-3772513 CAGCTCAGTGTGTTTGCCCTGGG - Intronic
1134305321 16:13026873-13026895 AAGCTCAGAGACTTTGGCTGCGG + Intronic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1135239780 16:20793971-20793993 CAGCTCCGGGGGCTTGGCATAGG + Intronic
1135852928 16:25980920-25980942 CAGCTCAGCAAGTTTAGGATTGG + Intronic
1136360261 16:29774863-29774885 CAGCTCAGAGAGGTCGAGATGGG - Intergenic
1138492556 16:57384746-57384768 CAGCTCAGAGAGGGTGGGAGTGG + Exonic
1138503604 16:57464526-57464548 CAGCTCAGAGAGTTTGGATTAGG + Intronic
1139099059 16:63743876-63743898 GAGCCCAGAGAGTTTGGTGTAGG + Intergenic
1144405443 17:14948637-14948659 CAGCTCAGAGACTTTGGGTAAGG + Intergenic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1144625674 17:16843344-16843366 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1144880757 17:18429376-18429398 CAGCTTTGAGAGTTTGAAATGGG - Intergenic
1145151478 17:20515011-20515033 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1146162828 17:30569261-30569283 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1146660716 17:34663526-34663548 CAGCTCAGAGAGTGCAGGATAGG - Intergenic
1147579833 17:41622039-41622061 CAGCTTTGAGAGTTTGAAATGGG + Intronic
1149441512 17:56678351-56678373 CAGCTCAGTTCCTTTGGCATGGG - Intergenic
1151141105 17:71993022-71993044 GAGCCCAGAGGGTTTGGCATAGG + Intergenic
1153454114 18:5261658-5261680 GATCCCAGAGAGTTTGGTATGGG + Intergenic
1157099589 18:44717128-44717150 GAGCTCAGAGGGTGTGGCACTGG - Intronic
1157573884 18:48730966-48730988 CAGCCCAGAGAGGCAGGCATGGG + Intronic
1157580939 18:48773794-48773816 CAGCTCAGGCAGGTTGGTATGGG - Intronic
1159351647 18:67282933-67282955 TTGCCCATAGAGTTTGGCATGGG - Intergenic
1159564360 18:70032065-70032087 GAGCCCAGAGAGTTTGGTATGGG + Intronic
1160689549 19:455151-455173 CAGCTCAGTGACTTTGTCATGGG - Intronic
1164495202 19:28754301-28754323 TAGCCCAAAGGGTTTGGCATGGG + Intergenic
1168662309 19:58176861-58176883 CTGTTCATAGAGTGTGGCATGGG + Intergenic
925786605 2:7437119-7437141 CAGCTCAGAAAGTTAAGGATTGG + Intergenic
926332021 2:11833393-11833415 AAGCACAGAGAGCTTGGTATGGG - Intergenic
927007028 2:18861531-18861553 CAGCCTAGAGGGCTTGGCATGGG - Intergenic
928730352 2:34224740-34224762 GAGCTCGGAGAGTTTGGAGTAGG + Intergenic
928858866 2:35831649-35831671 CAGCTCACAGAGTCAGGCAGAGG + Intergenic
929888659 2:45901327-45901349 CAGGTCGGAGCGTTTGGCCTTGG - Intronic
932958884 2:76388870-76388892 CAGATGAGAGAGGTTGGCTTTGG + Intergenic
935244492 2:101206324-101206346 AAGGTCAGAGAGTTGGGCAGGGG + Intronic
935642836 2:105307158-105307180 CAGCCCTGAGAGTTCTGCATCGG - Intronic
936692804 2:114912873-114912895 GAGCCCAAAGAGTTTGACATGGG + Intronic
937001733 2:118474012-118474034 TAACTCAGAGACTTTAGCATGGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942603042 2:177660929-177660951 CAGAACAGCGAGTTTGGCAGGGG - Intronic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943819697 2:192305284-192305306 CAGCTCAGTGATTTTCCCATAGG + Intergenic
943858464 2:192828662-192828684 CAGCTCAGAGAGATCGGCAGCGG - Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945347162 2:208732030-208732052 GAGCCCAGAGTGTTTGGCACAGG - Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948246933 2:236494694-236494716 CAGCCCAGAGAATTTTGGATAGG + Intronic
1169663929 20:8012952-8012974 CAGCTCTGAGTCTTTAGCATGGG + Intronic
1171280492 20:23892130-23892152 CAGATGAGAGAATATGGCATTGG - Intergenic
1172770861 20:37381903-37381925 CAGCTCAGAGAATGTGGGGTTGG - Intronic
1175087458 20:56471748-56471770 CACCTCAGAGAGTTGGGGACAGG - Intronic
1178513627 21:33228484-33228506 CAGCACATGGAGTTTGGTATTGG + Intergenic
1179572252 21:42284652-42284674 CAGCTCGAAGAGTTTGGCGCTGG - Exonic
1181915540 22:26276900-26276922 GAGCCCAGAGAGTCTGGCACAGG - Intronic
1182547193 22:31083170-31083192 CAGCTCAGAGAATTCTGCAGGGG - Exonic
949385747 3:3500602-3500624 CACCTCAGAGAGGTGGGCAGAGG + Intergenic
949648954 3:6132617-6132639 CAGCTTAGAGAGTATGGGAGAGG - Intergenic
950166396 3:10803632-10803654 CAAGTCAGAGAGATTGGCAAGGG - Intergenic
950262607 3:11553695-11553717 GAGCTCAGATAGTTTGGCCTCGG + Intronic
950704044 3:14769219-14769241 GAGCTCAGAGGGCTTGGCAGAGG + Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
951451123 3:22839810-22839832 CAGCTCAAAGACTTTGGCTTAGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
954036882 3:47855603-47855625 CAGCTCAGTGGCTGTGGCATGGG - Intronic
954293047 3:49659848-49659870 CAGCCCAGAGGGTTTGGCAGAGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956378864 3:68644887-68644909 GAGCCCAGAGGGTTTGGCGTGGG - Intergenic
957736709 3:84213092-84213114 GAACCCAGAGAGTTTGGCACAGG + Intergenic
958439024 3:94133203-94133225 AAGTTCAGAGAGATTGGCAATGG + Intergenic
958460035 3:94383183-94383205 GAGCCCAGAGGGTTTGGCACAGG + Intergenic
958462595 3:94418322-94418344 GAGCCCAGAATGTTTGGCATGGG + Intergenic
960015709 3:112885450-112885472 AAGCCCAGAGGGTTTGGCATGGG - Intergenic
961499796 3:127324081-127324103 GAGCTCGGTGAGTTTGGCAGAGG + Intergenic
962032645 3:131617614-131617636 TAGCACAGGGAGTGTGGCATGGG - Intronic
962655809 3:137542900-137542922 GAGCCCAGAGGGTTTGGTATGGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964142553 3:153420232-153420254 GAGCCCAGAAGGTTTGGCATGGG - Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
966970200 3:185038681-185038703 CAGCTCAGAGATTTTTCCTTGGG - Intronic
968313580 3:197703930-197703952 CAGCCCCGAGAGTTGGGCATTGG - Intronic
972363542 4:38351350-38351372 GAGCCCAGGGAGTTTGGCACAGG + Intergenic
973034678 4:45391025-45391047 GAGCCCAGAGGGTTCGGCATAGG - Intergenic
973291025 4:48470784-48470806 CAGCCCAGACAGTTTCACATTGG + Intergenic
973720824 4:53721617-53721639 CAGGTGAGAGAGTTGGGGATTGG + Intronic
974543833 4:63275087-63275109 CAGCCCAGAGGGTTTGGCACAGG + Intergenic
976111413 4:81677846-81677868 TAGCTCAGAAAGTCTGGGATCGG + Intronic
978195860 4:105971131-105971153 CAGTTCAGAGAGATTTTCATCGG + Intronic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
980322323 4:131294014-131294036 GAGCTCAGAGGGTTTGCCACAGG - Intergenic
980379243 4:131990102-131990124 CAGCCCTGAGAGTTCTGCATTGG - Intergenic
981276282 4:142901239-142901261 GAGCCCAAATAGTTTGGCATGGG - Intergenic
981542198 4:145857677-145857699 GAGCTCAGAGAGATTAGCTTTGG + Intronic
983379559 4:166974301-166974323 AAGATCATAGAGTTTGGAATTGG + Intronic
983778634 4:171641156-171641178 TAGTTCAGAGAGTTTGGAAGAGG - Intergenic
983784888 4:171718372-171718394 GAGCCCAGCGGGTTTGGCATGGG + Intergenic
984236003 4:177159754-177159776 GAGCTCAGAGGGTTTGGCACAGG + Intergenic
985061474 4:186083677-186083699 CAGCTCAGGGATGTTGGTATGGG - Exonic
988118052 5:26921601-26921623 CAGCCCCGAGAGTTCTGCATTGG - Intronic
989414144 5:41153818-41153840 CAGGTGAGAGAGTTTGAAATGGG + Exonic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991243898 5:64489088-64489110 GAGCCCAGAGGGTTTGGCATGGG + Intergenic
992087339 5:73289766-73289788 AAGCTCAGGGAGTTTTACATGGG + Intergenic
992767733 5:80016845-80016867 CAGCACAGGGAGTGTGGTATGGG - Intronic
993438464 5:87925897-87925919 GAGCCCAGAGAGTTTGGCATGGG + Intergenic
995972582 5:117990444-117990466 CAGCTCACAGAGGATGGCTTTGG + Intergenic
996379639 5:122849919-122849941 CAGCTCAGAGAGTTAGGTGGAGG + Intronic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
997021467 5:130007675-130007697 AAGCCCAGAGAGTTTGGTGTGGG + Intronic
998183556 5:139962001-139962023 CAGCACAGAGAGCTGGTCATTGG + Intronic
998250066 5:140546701-140546723 AAGGTCAGAGAGTTTGGCCTTGG - Intronic
998821330 5:146060285-146060307 CAGCTCAGAGATTTTAGTGTTGG + Intronic
1003053931 6:2802640-2802662 CAGCTCAGAGAGCCTGACAAAGG + Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007591837 6:43026197-43026219 CAGGTTAGAGAGTTGGGCAGGGG + Intronic
1008020780 6:46575225-46575247 GAGCCCAGAGGGTTTGACATGGG + Intronic
1009446548 6:63749576-63749598 GAGCCCAGAGGGTTTGGAATGGG - Intronic
1009598802 6:65771628-65771650 GAGCCAAGAGGGTTTGGCATGGG + Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1013393851 6:109714053-109714075 GAGCCCAGAGGGTTTGGTATGGG - Intronic
1014229106 6:118882247-118882269 TAGCTCAGAGAGTTTGACCAGGG + Intronic
1014841482 6:126225180-126225202 CAGCCCAGAGTGTTTGGCACAGG - Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1016332117 6:142964517-142964539 CAGCTCAATGAGTTTTGAATAGG + Intergenic
1018337807 6:162814335-162814357 CAGCCAAGTGTGTTTGGCATTGG - Intronic
1018977685 6:168577846-168577868 CAGAACTGAGAGTTTGGCTTTGG + Intronic
1019888147 7:3923572-3923594 CAGCTCAGAAACTCTGGTATGGG + Intronic
1020503978 7:8960087-8960109 CAGCTCAAAGAATTTTGCTTAGG - Intergenic
1020607855 7:10360546-10360568 GAGCCCAGAAAGTTTGGGATGGG - Intergenic
1022335051 7:29414466-29414488 CGGCTCTGAGAGTTGGGAATTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024020682 7:45365275-45365297 CTGCTTAGAGATTGTGGCATTGG - Intergenic
1025160784 7:56658921-56658943 CACCTCTGAGAGATTGGCCTGGG - Intergenic
1028347339 7:89798776-89798798 GAGCCCAGAGGGTTTGGTATAGG - Intergenic
1028666970 7:93356694-93356716 CAACTCAGTGAGCTTGGTATGGG + Intronic
1031256112 7:119450678-119450700 GAGCCCAGATGGTTTGGCATGGG - Intergenic
1031949380 7:127876285-127876307 CAGCTGACAGTGTTTGGAATTGG + Intronic
1032086002 7:128884294-128884316 CATCTCAGAGACTAGGGCATGGG - Intronic
1032310341 7:130780386-130780408 GAGCCCAGAGGGTTTGGCACAGG - Intergenic
1033975601 7:147096829-147096851 CACCTCAGTGATTTGGGCATTGG - Intronic
1034063753 7:148117356-148117378 CACCTCTGAGAGTTTGGCGCAGG + Intronic
1036054719 8:5238910-5238932 AAGCCCAGAGGGTTCGGCATGGG + Intergenic
1039087438 8:33793941-33793963 CAGTTCAGAGAGTTCCACATGGG + Intergenic
1039228981 8:35422128-35422150 CAGCTCGGAGAGTGTGAGATGGG - Intronic
1039799926 8:40945114-40945136 CAGCTCAGAAAGTGTGACAGAGG - Intergenic
1040118714 8:43656099-43656121 CATCTCAGAGAGTTAAACATTGG + Intergenic
1041013325 8:53566411-53566433 CAGCTCAGACAGTTAGGGTTAGG + Intergenic
1043820951 8:84863422-84863444 CAGGTCAGAGAGTTAGACACAGG + Intronic
1044026959 8:87184477-87184499 AAGCCCAGAGGGTTTGGCGTGGG - Intronic
1044165379 8:88976063-88976085 CAGTACAGAGAGATTGGCAAAGG + Intergenic
1045234040 8:100334170-100334192 ATGCTCCGAGAGTTTGGCAAAGG - Intronic
1047580755 8:126212581-126212603 AAGCCCAGAGGGTTTGGAATAGG - Intergenic
1048981848 8:139706606-139706628 CAGCCCAGAGAGTCTGGCTGGGG + Intergenic
1050854014 9:10327803-10327825 CTTCTCAAAAAGTTTGGCATTGG - Intronic
1050928609 9:11297309-11297331 AAGCCCAGAGAGTTTGGTGTAGG - Intergenic
1050965426 9:11795573-11795595 GAGCCCAGAGGGTTTGGCACAGG - Intergenic
1051164411 9:14246686-14246708 CAAATAAGAGGGTTTGGCATAGG - Intronic
1052392151 9:27892762-27892784 CAGCTCAGGGAGTTGGGAGTTGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058643266 9:107107502-107107524 CAGCTCACAGAGTGTGGTGTTGG - Intergenic
1059418679 9:114177727-114177749 CAGCACACAGAGCATGGCATGGG - Intronic
1059510331 9:114839402-114839424 GAGGCCAGAGGGTTTGGCATGGG + Intergenic
1059567564 9:115398307-115398329 CAGCCCAGTGTGGTTGGCATGGG - Intronic
1060598155 9:124860544-124860566 CAGCTCATTGAAATTGGCATTGG - Intronic
1061900747 9:133670849-133670871 CAGCTCTGAGAGTGTGGCTAGGG - Intronic
1186407564 X:9317278-9317300 CAGCTCAGAGAGGCATGCATGGG + Intergenic
1187198271 X:17109292-17109314 CCTCCCAGAGATTTTGGCATGGG + Intronic
1188147400 X:26630526-26630548 GAGCCCAGAGGGTTTGGCATGGG - Intergenic
1188493001 X:30755832-30755854 GAGCCCAGAGGGTTTGGCAGGGG + Intergenic
1188806866 X:34601623-34601645 CAGCCCAGAGAGTTTAGTACAGG - Intergenic
1188886736 X:35560546-35560568 GAGCCCAGAGGGTTTGGCACAGG + Intergenic
1188921718 X:35985836-35985858 GAGCCCCGAGGGTTTGGCATGGG - Intronic
1188976662 X:36683625-36683647 CAGCCCTGAGAGTTTGGAAGCGG + Intergenic
1189203442 X:39217467-39217489 CAGCTCTGTGAGTTTGCCTTTGG + Intergenic
1190604479 X:52126659-52126681 GAGCCCAGAGGGTTTAGCATAGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191643466 X:63452865-63452887 AAGCTCAGAGAATTTGACACAGG + Intergenic
1192038756 X:67594650-67594672 CACATCAGAGAGTTTTTCATTGG - Intronic
1192183584 X:68931100-68931122 CTTCTCAGATAGTTGGGCATGGG - Intergenic
1193577254 X:83214599-83214621 GAGCTGAGAGGGTTTGGCATGGG + Intergenic
1193979945 X:88169480-88169502 AAGCACAGAGCGTTTGGCATAGG - Intergenic
1194356885 X:92896336-92896358 CAGCCCAGAGGGTTTGGCATGGG - Intergenic
1195289169 X:103414735-103414757 GAGCCCAGAGAGTTTGGTACAGG - Intergenic
1196287167 X:113896318-113896340 CAGCTCAGAGATTTTGCCCTTGG + Intergenic
1196554366 X:117069966-117069988 GAGCTCAGAGGGTTTGGTGTGGG + Intergenic
1196682782 X:118485773-118485795 CAGCTAAGAGAGGTGGGGATAGG - Intergenic
1196742563 X:119038223-119038245 CAGCTAAGAGAGGTGGGGATAGG - Intergenic
1197760656 X:130025524-130025546 CAGCTCCGAGCCTTTGGCTTTGG + Intronic
1198579584 X:138048946-138048968 GAGCTCAGAGGGTTTGGCATGGG + Intergenic
1198841737 X:140864901-140864923 GAGCCCAGAGGGTTTGGCATGGG + Intergenic
1200287669 X:154839021-154839043 CAGATCAGAGACTTGGGCAGGGG - Intronic
1200665218 Y:6013330-6013352 CAGCCCAGAGGGTTTGGCATGGG - Intergenic
1200930378 Y:8691584-8691606 CAGCTCTGACAGTTGGGCACTGG - Intergenic