ID: 1012258378

View in Genome Browser
Species Human (GRCh38)
Location 6:97060381-97060403
Sequence GAGGATGAGCTGAAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1726
Summary {0: 1, 1: 1, 2: 35, 3: 313, 4: 1376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012258378 Original CRISPR GAGGATGAGCTGAAGAAGGA GGG Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900642677 1:3694893-3694915 GAGGAGGGGCTGAAGATGCATGG - Intronic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
901239965 1:7687221-7687243 GAGGAGGAGCTGGCCAAGGAGGG + Intronic
901812877 1:11777812-11777834 GAGGATGGGCTGGAGAGGGAGGG - Intronic
901910325 1:12452302-12452324 GAGGATGGGATCATGAAGGATGG + Intronic
902045919 1:13524230-13524252 GAGGAAGGGCTGGGGAAGGATGG + Intergenic
902411244 1:16212661-16212683 GAGGGGGAGGTGAAGGAGGAGGG + Intergenic
902941232 1:19801354-19801376 GGAGATGAGCAGATGAAGGAAGG - Intergenic
903326830 1:22573664-22573686 GAGGAGGAGCTGGAGGATGAGGG - Intronic
904286029 1:29453801-29453823 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
904984904 1:34537413-34537435 GAAAATGAGCTGGAGATGGAAGG - Intergenic
905109364 1:35584034-35584056 GAGGATGAGCTGGAGTATGGAGG - Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905477779 1:38240989-38241011 GATGGTAAGTTGAAGAAGGATGG + Intergenic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905926180 1:41751515-41751537 GAGGATGTGGTGAGGAGGGAAGG + Intronic
905951304 1:41953747-41953769 GATAATGAGAGGAAGAAGGAAGG + Intronic
906107355 1:43302775-43302797 GAGGATGAGTTGCAGAAGGAGGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
907151775 1:52295458-52295480 GAGGCTGAGAGGTAGAAGGATGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907600040 1:55760235-55760257 GAGGGTGAGCCGAAGCAGGTGGG + Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908235399 1:62143033-62143055 GATGATGAACTGAATTAGGATGG + Intronic
908440036 1:64144040-64144062 GAGGAGGAGTGGAAGACGGAGGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908813579 1:68009057-68009079 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
908936018 1:69376501-69376523 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
909261311 1:73492131-73492153 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909448971 1:75777735-75777757 GAGGGTGAGCTGAAGCAAGGTGG + Intronic
909686554 1:78355240-78355262 GAGGTAGAGAAGAAGAAGGAGGG - Intronic
909707777 1:78607839-78607861 GAGGGTGAGCTGAAGAAGAGGGG + Intergenic
910093492 1:83493281-83493303 GAGGATCAGCTGATGAGGTATGG - Intergenic
910176456 1:84436039-84436061 AAGGATGGGCTGAAGGGGGAAGG + Intergenic
910383558 1:86657589-86657611 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
910554604 1:88517477-88517499 GAGGAGGAGAAGAGGAAGGAAGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910841981 1:91569829-91569851 GAAGAGGAACGGAAGAAGGAAGG + Intergenic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
910931438 1:92446294-92446316 GGGGATGGGCTGAAGTGGGATGG - Intergenic
911270572 1:95797057-95797079 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911342039 1:96651403-96651425 GAGGGTGAGCTGAAGAAGGGCGG + Intergenic
911399530 1:97357973-97357995 GAGGATGAGCTGAAGCAGTGGGG + Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
911546919 1:99228169-99228191 GAGAATGAGATGAAGAAAGCGGG + Intergenic
911636204 1:100238450-100238472 GAGGAGGAGAAGGAGAAGGAAGG - Intronic
911993436 1:104732650-104732672 TAGGAAGAGCTGTAGAAGGCCGG + Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912069557 1:105792708-105792730 TAGGAGGAGGTGAAAAAGGAAGG - Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913108742 1:115639768-115639790 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
913161148 1:116147135-116147157 CAGAAGGAGCTGAAGAAGCAGGG - Intergenic
913458208 1:119055721-119055743 GAGGAGGAGGAGAAGAGGGAGGG + Intronic
913607359 1:120478307-120478329 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
913650908 1:120913174-120913196 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914170205 1:145215893-145215915 GAGGAAGAGGTGGAGGAGGAGGG + Intergenic
914209074 1:145561832-145561854 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
914263632 1:146019726-146019748 GAGAATGAGCTAAAGACAGAAGG + Exonic
914267993 1:146054198-146054220 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
914369101 1:147006661-147006683 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
914525322 1:148459859-148459881 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
914583835 1:149043527-149043549 GAGGATGAGCCAAAGCAGGGTGG - Intronic
914598351 1:149175971-149175993 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914641078 1:149607269-149607291 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915514678 1:156405971-156405993 GAGGAGGAGCTGGGGAAGGGAGG - Intronic
915516831 1:156418290-156418312 GGGGTTGAGCTGAGAAAGGAAGG - Intronic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915989523 1:160499731-160499753 TAGGAGGAGCTGAATAGGGAAGG + Intronic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916171991 1:162008433-162008455 GCAGGTGAGCTGAAGAAGCAAGG - Intronic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916348989 1:163827276-163827298 CAGGAGGAAATGAAGAAGGAGGG - Intergenic
916379206 1:164189577-164189599 GGGGCTGAGCTGAAACAGGAGGG + Intergenic
916379619 1:164195447-164195469 GAGGTTGAGCTGAAGCGGGGTGG + Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916855201 1:168741948-168741970 GAAGATGAGGTGAGGAAAGAGGG - Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
917268500 1:173247357-173247379 GAGTATGTTCTGAAGGAGGAGGG + Intergenic
917764187 1:178199275-178199297 GAGGGCGAGCTGAAGGAGGGTGG - Intronic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
918048383 1:180954568-180954590 GAGGATGAGCTGGAGCTGGCCGG + Intergenic
918135566 1:181670917-181670939 GAGCAAGAGCTGAAGGAGGAAGG + Intronic
918149149 1:181783083-181783105 AAGGATGAGGTGGAGCAGGATGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918353760 1:183684884-183684906 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
918822512 1:189273089-189273111 GAGGATGAGCTGGCGAAAGAAGG + Intergenic
918968268 1:191378780-191378802 GAGGGTGAGCCAAAGCAGGACGG - Intergenic
919020632 1:192100873-192100895 GTGTAAGAGTTGAAGAAGGAAGG + Intergenic
919055565 1:192565733-192565755 GAGGGAGAGCGGCAGAAGGAAGG + Intergenic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
919675890 1:200382667-200382689 GATAATGAGCTGGAGAAGAATGG - Intergenic
919870837 1:201820054-201820076 GAGGAGGAGATGAAAGAGGAGGG + Exonic
920432831 1:205929581-205929603 GAGTTTGGGCTGAAGGAGGAGGG + Intronic
920503652 1:206501298-206501320 GAGGGGGAGATGAAGAGGGATGG + Intergenic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
920993192 1:210959879-210959901 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921184097 1:212655517-212655539 GAGGATGGCCTGCAGAGGGAGGG + Intergenic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921931004 1:220754237-220754259 TGGGATGAGCTGAAGAGTGAGGG - Intronic
921976253 1:221206728-221206750 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922143459 1:222914484-222914506 GAGGATGAGTGAAAGAAAGAGGG - Intronic
922208170 1:223467084-223467106 AAGGATGAGCTGGAGAAGGCTGG - Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922428048 1:225517913-225517935 GAGGAGGTGCTGAAGGAGGCTGG + Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922723295 1:227909822-227909844 GAGGAAGAGGGGAGGAAGGAAGG + Intergenic
922997530 1:229976397-229976419 AACAAAGAGCTGAAGAAGGAAGG + Intergenic
923067062 1:230527567-230527589 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
923472445 1:234304090-234304112 GAGGGAGAGAGGAAGAAGGAAGG - Intronic
923492320 1:234494940-234494962 TAGGATGAATTGGAGAAGGAGGG + Intergenic
923658539 1:235939120-235939142 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
923690997 1:236192635-236192657 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
923794025 1:237136029-237136051 GAAGAGGATCTGAAGAAGAAGGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
923877275 1:238062833-238062855 GAGAAGGAGCAGAGGAAGGATGG - Intergenic
924130419 1:240901258-240901280 GACCATGAGCTGAAGCAGGGTGG - Intronic
924220115 1:241865627-241865649 GAATTTGAGCTGATGAAGGATGG - Intronic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924327309 1:242908926-242908948 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
924434143 1:244023638-244023660 GAGGAAGGGCTCAAGAAGGGAGG + Intergenic
924494105 1:244569232-244569254 GAAGACGAGCTGAAGCAGGGTGG - Intronic
924654027 1:245956645-245956667 GAGGAGGAGAAGTAGAAGGAGGG - Intronic
924704710 1:246491000-246491022 GAGGATAATCTGAAGAGGCAGGG + Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063487624 10:6434778-6434800 GAGGAGGGACTGAAGAGGGAAGG - Intronic
1063646860 10:7893740-7893762 GGTGAAAAGCTGAAGAAGGAAGG - Intronic
1063999827 10:11654222-11654244 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1064213609 10:13381457-13381479 GAGAATGAACTGACGAGGGAAGG + Intergenic
1064492925 10:15878513-15878535 GAGGGGGAGCTGAAGCAGGGCGG - Intergenic
1065076082 10:22080592-22080614 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
1065076874 10:22089421-22089443 GAAGGTGAGCTGAAGCAGGGTGG + Intergenic
1065159059 10:22900347-22900369 GATGATGGGGTGAAAAAGGAAGG - Intergenic
1065392107 10:25193352-25193374 GACTCTGAGCTGAGGAAGGAAGG + Intronic
1065792637 10:29275505-29275527 TAGGATGAGCTGATGATGGAAGG - Intergenic
1065907566 10:30271962-30271984 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1066047439 10:31605494-31605516 GAGGAAGGGCTGAAGTAGGGGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066106943 10:32164848-32164870 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066106980 10:32165033-32165055 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1067968496 10:50942045-50942067 TGGGAGGACCTGAAGAAGGAGGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068759324 10:60690255-60690277 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069718496 10:70535485-70535507 GAGGAAGAGAGGGAGAAGGAAGG - Intronic
1069987053 10:72291747-72291769 AGAGATGAGCTGAAGAGGGAGGG + Intergenic
1070007134 10:72435562-72435584 GAGGACGAGCTGAAGCAGGGCGG + Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070506555 10:77118468-77118490 GAGGATGAGGTTAAGAGGGTAGG - Intronic
1070713480 10:78700530-78700552 GAGGATGTGAGTAAGAAGGAAGG + Intergenic
1070755380 10:78988829-78988851 AAGGATGAGGTGGAGAAGGAAGG - Intergenic
1071438725 10:85670637-85670659 GAGCAGGAGATGAAGATGGAGGG - Intronic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071714387 10:88080574-88080596 GTGAATGTGCTGAAGATGGATGG + Intergenic
1071876665 10:89850482-89850504 GAAAATGATCTGAACAAGGAGGG - Intergenic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072374527 10:94800991-94801013 GAGGGTGAGCTGAAGAAGGGTGG - Intronic
1072477649 10:95778117-95778139 GAGGACGAGCTGAAGCAGGGCGG - Intronic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072729006 10:97832195-97832217 GGGCATGAGCTGAAGCTGGAGGG + Intergenic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1072893017 10:99341661-99341683 GAGTTTGAGCTGAAAAAGAAAGG + Intronic
1073021568 10:100448996-100449018 GAGGAGGAGAGAAAGAAGGAGGG + Intergenic
1073694457 10:105849502-105849524 GAGGGTGAGCTGAAAGAGGGTGG + Intergenic
1073757805 10:106599382-106599404 GAGGAGGAGGAGGAGAAGGAAGG + Intronic
1073978863 10:109131555-109131577 GAGGGTGAGCCGAAGCAGAATGG + Intergenic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074105961 10:110389901-110389923 GTGGATGAGTTGAAGCCGGAGGG - Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1074997595 10:118771190-118771212 GAAGAAGACCTGAAAAAGGAAGG - Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1075923448 10:126232292-126232314 GAGGATGAGGTCAAGAACCAGGG + Intronic
1076374598 10:129974774-129974796 GTGGTTGGGCTGGAGAAGGAAGG - Intergenic
1076634727 10:131874892-131874914 GAGGAGGAGCTCGAGGAGGAGGG + Intergenic
1077280498 11:1742872-1742894 GAGGATGAACAGATGATGGATGG + Intronic
1077388520 11:2287632-2287654 GAGGAAGAGATGAAGAAAGGGGG + Intergenic
1077611289 11:3644557-3644579 GATGCTGAGTTAAAGAAGGAAGG + Intergenic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1078793546 11:14569386-14569408 GAGCATGAGGTGAAGCAGGGTGG + Intronic
1078912836 11:15749364-15749386 GAAGGTGAGCTCAAGAAGGAAGG + Intergenic
1078981133 11:16536474-16536496 GAGGGTGAGCTGAAGAAGGGCGG + Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1079928993 11:26533952-26533974 AAGCATGAGCTCAAGAGGGATGG - Intronic
1079954088 11:26841261-26841283 GAGGCTGGGGTGAACAAGGAAGG + Intergenic
1080303399 11:30810559-30810581 GTGGTTGAGTTGAGGAAGGAAGG - Intergenic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1080604678 11:33855164-33855186 GAGGAAGAACGGAAGGAGGAAGG + Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081071826 11:38619776-38619798 GAGTAGCAGATGAAGAAGGAAGG - Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081221505 11:40469226-40469248 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1081408157 11:42722274-42722296 GAGGCAGATGTGAAGAAGGAAGG - Intergenic
1081761499 11:45579599-45579621 GAGAAGGAGGAGAAGAAGGAAGG - Intergenic
1081887125 11:46507532-46507554 GAGGATGCGCTAAAGGAGCAGGG - Intronic
1081958972 11:47119427-47119449 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083003716 11:59321429-59321451 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1083337382 11:61931637-61931659 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1083385607 11:62306956-62306978 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1083497023 11:63064401-63064423 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083516310 11:63262107-63262129 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1083541357 11:63513743-63513765 AGGGATGAGGTGAAGAAGGAGGG - Intronic
1083723802 11:64618117-64618139 GAGGAGGCGCTGAAGCAGGCGGG - Intronic
1084308100 11:68299557-68299579 GAGGAAGAGCTGAAGGGGAAGGG + Intergenic
1084932924 11:72571251-72571273 GGGGGTGTGCTGAGGAAGGATGG - Intergenic
1085705983 11:78787088-78787110 GGGGAGGAGCAGAAGAAGGGAGG + Intronic
1085753938 11:79188512-79188534 GAGGAGGAGAGGAAGAAGGAGGG + Intronic
1085884369 11:80505397-80505419 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
1086086116 11:82956681-82956703 GAGGGTGAGCTGAAGCAGCGTGG - Intronic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086456913 11:86968064-86968086 GAGGGTGAGCCGAAGTAGGGTGG - Intergenic
1086494325 11:87386668-87386690 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1086504795 11:87494115-87494137 GACGCTGAGTTAAAGAAGGAAGG + Intergenic
1086506334 11:87508221-87508243 GAGGGTGAGTTGAAGCAGGGTGG - Intergenic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086731832 11:90259565-90259587 GAGGATGAAGGGAGGAAGGAGGG + Intergenic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1087203736 11:95372419-95372441 GAGGAAGAGGAGGAGAAGGAGGG + Intergenic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1087364241 11:97198693-97198715 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1087925058 11:103910443-103910465 GAAGGTGAGCTGAAGCAGGGTGG + Intronic
1088056918 11:105594067-105594089 CAGAATGAGTGGAAGAAGGAAGG - Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088381102 11:109193320-109193342 GAGGGTGAGTTGAAGCAGGATGG - Intergenic
1088919662 11:114251750-114251772 GAGGAGGAGGAGCAGAAGGAGGG + Intergenic
1089101011 11:115962500-115962522 GAGACTGAGCTAAAGCAGGAAGG - Intergenic
1089123179 11:116155496-116155518 GAGGAGGAGGAGAGGAAGGAGGG + Intergenic
1089190107 11:116647583-116647605 GTGAGTGAGTTGAAGAAGGAAGG + Intergenic
1089245859 11:117119201-117119223 GGTGATGAGCTGAAAAGGGAAGG + Intergenic
1089542136 11:119195760-119195782 GAGGATGATGGGAAGAGGGAGGG - Intronic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1089725091 11:120470225-120470247 GAGAATGAGTTGAAGAAGGGTGG + Intronic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090569525 11:128031154-128031176 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090827806 11:130400220-130400242 GGGGATGAGCTGGAGGAGCATGG + Intergenic
1091690122 12:2590201-2590223 GAGGATGAGCATCAGATGGAGGG + Intronic
1091903483 12:4164611-4164633 GAGGAGGAGCAGGAGAAGGCGGG - Intergenic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092094585 12:5831142-5831164 GAGGATGCACTGATGAAGGAAGG + Intronic
1092159643 12:6309267-6309289 CAGGATGCTCTGAAGAAGTAAGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092581765 12:9849879-9849901 GAGGCTGAGCCGAAGCAGGGTGG - Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092661963 12:10748206-10748228 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1093004334 12:14035620-14035642 GAGGGTGAGCCAAAGCAGGATGG + Intergenic
1093236047 12:16609524-16609546 GATGATGAGTTGCAGAAAGAGGG - Intronic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094234383 12:28146849-28146871 GAGGAGGAGAAGAAGAAAGAAGG - Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1094531907 12:31283737-31283759 GAGGATGAGATGAGGTAGGATGG - Intronic
1094757774 12:33492412-33492434 GAGGGTGAGCTGAAGAAGGGTGG + Intergenic
1095095477 12:38145877-38145899 GCAGATGAACTGAAAAAGGATGG + Intergenic
1095140504 12:38657048-38657070 GAGGGTGAGCTGAAGCAGTGCGG + Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096263514 12:50107055-50107077 TAGGAGGAGCTGCAGAAGCAAGG + Intronic
1096886155 12:54721334-54721356 GAGGAGGAGTGGCAGAAGGAGGG - Intergenic
1096916096 12:55035103-55035125 TAGGATGAATTGTAGAAGGAAGG - Intergenic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097403192 12:59154855-59154877 AAGGATGAGATCAAGAATGAAGG + Intergenic
1097548458 12:61035406-61035428 GAGGAGCACCTGAAGATGGAGGG - Intergenic
1097575940 12:61392634-61392656 GAGGATGAGTGGATGAATGATGG - Intergenic
1097613603 12:61857762-61857784 GAGGAGGTGCAGGAGAAGGAGGG - Intronic
1097710324 12:62910654-62910676 GAGAATTAGCTGACGAAGGAAGG + Intronic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1097935931 12:65250951-65250973 GAGGATGGGGTGAAGTAGAAAGG + Intergenic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098560866 12:71870377-71870399 TAGGATGAGCTGAGAAAGGGTGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098635535 12:72780040-72780062 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099216608 12:79861482-79861504 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099486331 12:83233109-83233131 GAGGGTGAGCGGAAGCAGGGTGG - Intergenic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099697548 12:86040975-86040997 GAGGGTGAGTTGAAGCAGGGTGG - Intronic
1099820319 12:87700731-87700753 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1099965483 12:89440795-89440817 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1100550698 12:95644222-95644244 GAAGAGGAGGAGAAGAAGGAGGG - Intergenic
1100900758 12:99238069-99238091 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1102019922 12:109675302-109675324 GAGGATGAGATGAAACAGGTGGG - Intergenic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1102390549 12:112545644-112545666 CTGGATGAGCTCTAGAAGGAGGG + Intergenic
1102531089 12:113547199-113547221 GAGGAAGAGGGGAAGATGGATGG + Intergenic
1102894439 12:116587455-116587477 GATGATGAGTTGATGATGGATGG - Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1103555785 12:121765774-121765796 GAGGAGGAGCTGGAGGAGGGCGG - Intronic
1103633499 12:122282957-122282979 CCGGATGAGCTGAAGTAGCACGG + Intronic
1104147010 12:126044322-126044344 CAGGATGAAGTCAAGAAGGAAGG + Intergenic
1104153706 12:126109962-126109984 GAGGAAGAGAGGGAGAAGGAAGG - Intergenic
1104175417 12:126326621-126326643 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1105769324 13:23593947-23593969 GAGGGTGAGCCAAAGCAGGATGG + Intronic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1106024786 13:25946473-25946495 GAGGAGGAGCTGAAGATGTTGGG - Intronic
1106153103 13:27125627-27125649 GAGGGTGAGCGGAAGCAGGGTGG + Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1106786906 13:33116305-33116327 GAGGGAGAGATGAAGAATGAGGG - Intronic
1106855536 13:33847441-33847463 GAGGAGGAGGTGAAGCAAGATGG - Intronic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1107092027 13:36491844-36491866 GAGGATGGGCTCAGTAAGGAAGG + Intergenic
1107449450 13:40495452-40495474 GAGGAGGAGCAGGATAAGGATGG - Intergenic
1107456006 13:40555132-40555154 GTGAATGAGCTGGAGAAGCAAGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108304519 13:49118200-49118222 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109048998 13:57453606-57453628 CAGGATGACCTGAAGAAATATGG - Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109551826 13:63914030-63914052 AAGCAAGAGTTGAAGAAGGATGG - Intergenic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111593286 13:90377763-90377785 GAGGAAGAGATGAAAAGGGAAGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1111850690 13:93570123-93570145 TAGGATGAGCTGAAGTACAATGG - Intronic
1112009316 13:95280667-95280689 AAGGATGAGGTGCAGCAGGAAGG - Intronic
1112412091 13:99173291-99173313 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1112462578 13:99615761-99615783 GAGGATGGGGTGAGAAAGGAAGG - Intronic
1112497548 13:99916600-99916622 GGCGATGAGATGTAGAAGGAAGG - Intergenic
1112972752 13:105281080-105281102 GAGAATGAGTCCAAGAAGGAGGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113300974 13:109018792-109018814 GAGGGTGAGCTGAAGCAGAGCGG - Intronic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113499744 13:110763982-110764004 GAGGATGAGTAGAAGACAGATGG + Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114288402 14:21267580-21267602 GGGGAAAAGTTGAAGAAGGATGG - Intronic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114981252 14:28168139-28168161 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
1115123174 14:29961335-29961357 GAGCGTGAGCTGAAGCAGGGTGG - Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115480013 14:33851433-33851455 GAGGATGAGCAGAGGTAGGGGGG + Intergenic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115769517 14:36655654-36655676 TAGGATGAACTGGAGAAGAATGG + Intergenic
1115843435 14:37498445-37498467 GAGGGTGAGCTGAAGAAAATTGG + Intronic
1116165590 14:41330335-41330357 GAAGGTGAGCTGAAGCAGGACGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116277676 14:42857465-42857487 TTTGATGAGCTGAAGAATGAAGG - Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1116416985 14:44689853-44689875 GAGGAGGAGGGGGAGAAGGAGGG + Intergenic
1116433680 14:44873929-44873951 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1116537153 14:46046974-46046996 GAGGGTGAAATGAAGAAGGAGGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117219335 14:53586589-53586611 GAGGATGAGAGGAAGAGAGATGG - Intergenic
1117437762 14:55733104-55733126 GAGGATGAGCTAGAGAAACATGG + Intergenic
1117617170 14:57545357-57545379 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1117829789 14:59739214-59739236 TAGGATGAGCTTAAAAGGGAGGG + Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1117900674 14:60529262-60529284 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1117930628 14:60837515-60837537 GAGGGTGAGCCAAAGCAGGATGG - Intronic
1118394082 14:65321006-65321028 GAGGAGGAGCGGGAGGAGGATGG + Intergenic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118766768 14:68915264-68915286 GAGGAGGAGGAGGAGAAGGAGGG - Intronic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1119084076 14:71723747-71723769 GAGGAAGAGGAGGAGAAGGATGG - Exonic
1119694119 14:76699000-76699022 GTAGAAGAGCTGAATAAGGAAGG + Intergenic
1119694890 14:76705348-76705370 GCGGATGAGATGAAGCTGGAGGG - Intergenic
1119759202 14:77139652-77139674 GAGGAAGAGCTGCAGCACGAAGG + Exonic
1119929111 14:78527352-78527374 GAGGAAGAGATGAAGTGGGAAGG + Intronic
1119977845 14:79045231-79045253 CAGTAGGAGATGAAGAAGGAGGG - Intronic
1119990330 14:79189555-79189577 GAGGAAGAGATAAAGAAGAAAGG - Intronic
1120041816 14:79762366-79762388 GATGTTGAACTGAAGAAAGAAGG + Intronic
1120061070 14:79983300-79983322 GAGGAAGAGAGGGAGAAGGAGGG + Intergenic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121057550 14:90872172-90872194 GAGAATGAGAGGAAGAAGAATGG + Exonic
1121211453 14:92210688-92210710 GACCAGGAGCTGAAGAAGGGAGG + Intergenic
1121222992 14:92300378-92300400 GAGGATGGACTGAAGACAGAGGG - Intergenic
1121249327 14:92488042-92488064 GAGGAGGAGGAGGAGAAGGATGG - Intronic
1121348864 14:93156953-93156975 GAGGAAGAGGGGAAGAGGGAGGG + Intergenic
1121470676 14:94151835-94151857 GAGGGTGAGCTGAAGCAGGTTGG - Intronic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122253957 14:100463181-100463203 GAGGAGGAGCAGAAGAAAAAAGG - Intronic
1122443403 14:101750223-101750245 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1123202615 14:106680859-106680881 GGGGATGAGATGAAGAAGGCTGG - Intergenic
1123210003 14:106750539-106750561 GAGGCTGAGGTGAAGAAGCCTGG - Intergenic
1123576718 15:21676792-21676814 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1123613340 15:22119260-22119282 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1124504566 15:30261861-30261883 TTGGAAGAGGTGAAGAAGGAAGG - Intergenic
1124738986 15:32276774-32276796 TTGGAAGAGGTGAAGAAGGAAGG + Intergenic
1124870767 15:33539902-33539924 GAGGAAGAGAAGGAGAAGGAGGG + Intronic
1124957748 15:34370823-34370845 GAGGAGGAGGAGAAGAAAGAAGG - Intergenic
1125354632 15:38803768-38803790 GAGGGTGAGCTGAAACAGGGTGG - Intergenic
1125746264 15:41999709-41999731 GAGGCTGAGTTGAAGATGGTGGG - Intronic
1125864855 15:43036755-43036777 GAGGATGAAGTGAAGAAATATGG + Intronic
1125984678 15:44038699-44038721 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1126087092 15:45021058-45021080 GAGGGTGAGCCGAAGCAGGGAGG - Intergenic
1126544753 15:49861240-49861262 GCGGATGAGTTAAGGAAGGAAGG - Intronic
1126592662 15:50355232-50355254 GGCGATGAGCTGAAGAGGGCCGG - Intronic
1126720044 15:51568953-51568975 GAGGTTGAGCTGAAGCAGGGTGG + Intronic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1127253920 15:57271561-57271583 GAGGGTGAGCTGAATCAGGGTGG - Intronic
1127665568 15:61143096-61143118 GAGGATCAACTGAAAATGGATGG + Intronic
1128053702 15:64684398-64684420 GAGGAGAAGCTAAAGAGGGAGGG + Exonic
1128142724 15:65313587-65313609 GAGGAAGAGTGAAAGAAGGAAGG - Intergenic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128554788 15:68623956-68623978 GAGGTTGAGCTGAGGAGGGCTGG - Intronic
1128788850 15:70417968-70417990 GATGAAGAGGTGAAGGAGGAGGG - Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129416492 15:75385277-75385299 GGTGCTCAGCTGAAGAAGGAGGG + Intronic
1129451543 15:75653820-75653842 CAGGATGAGCGGTAGAGGGAAGG - Intronic
1129495680 15:75977609-75977631 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1129530438 15:76260580-76260602 CAGGATGAGCTGACAATGGAGGG - Intronic
1129633864 15:77293221-77293243 GAGTATGAGATAAAGAGGGAAGG - Intronic
1130509515 15:84577334-84577356 GGTGCTCAGCTGAAGAAGGAGGG - Intergenic
1130585649 15:85179398-85179420 GGTGCTGAGCTGAAGAAGCAGGG + Intergenic
1130680939 15:85996207-85996229 GAGGGTGAAGTGAATAAGGATGG - Intergenic
1130903034 15:88221275-88221297 GAGGATGAGATGATGATGGATGG + Intronic
1130927487 15:88396441-88396463 GAGGAGGAGCAGGAAAAGGAAGG - Intergenic
1131139862 15:89968233-89968255 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1131186954 15:90282595-90282617 GGTGCTCAGCTGAAGAAGGAGGG + Intronic
1131395464 15:92082109-92082131 GAGGAGGAGGTGAACAGGGAAGG - Intronic
1131473309 15:92714739-92714761 GAGGAGCCGCTGGAGAAGGAAGG - Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1202985586 15_KI270727v1_random:411037-411059 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1133332141 16:4981473-4981495 GAGACTGAGCAGTAGAAGGAAGG + Intronic
1133520221 16:6549363-6549385 GAGGAGGAGGGGAAAAAGGAGGG + Intronic
1133612609 16:7447649-7447671 CAGGAAGAGCTGAAGATGCAAGG - Intronic
1133922521 16:10166423-10166445 GAAGATGAGCTGTAGAGGGAAGG - Intronic
1134019683 16:10912847-10912869 GAGGAGGTTCTGAGGAAGGAAGG + Intronic
1134167386 16:11941447-11941469 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1134493310 16:14712249-14712271 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1134498691 16:14751373-14751395 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1134525245 16:14938003-14938025 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1134547650 16:15122916-15122938 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1134712833 16:16336487-16336509 GAGGAGGAGGAGAAGAAGAAAGG - Intergenic
1134720698 16:16379805-16379827 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1134904954 16:17972244-17972266 AAGGAGGAGCTGAGCAAGGATGG - Intergenic
1134946729 16:18332080-18332102 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1134953994 16:18372206-18372228 GAGGAGGAGGAGAAGAAGAAAGG + Intergenic
1135312819 16:21419095-21419117 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1135365742 16:21851375-21851397 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1135446072 16:22519787-22519809 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1135512026 16:23094017-23094039 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135937522 16:26793671-26793693 GAGAAGGAGCAGAAGAGGGAGGG - Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1136194766 16:28644340-28644362 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1136211100 16:28758439-28758461 GAGGAGGAGGAGAAGAAGAAAGG - Intronic
1136255821 16:29038397-29038419 GAGGAGGAGGAGAAGAAGAAAGG - Intergenic
1136322932 16:29499603-29499625 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1136361064 16:29780079-29780101 GAGGAAGAGGGGAGGAAGGAAGG - Intronic
1136437616 16:30239571-30239593 GAGGAGGAGGAGAAGAAGAAAGG + Intronic
1136731506 16:32417773-32417795 GAGGGTGAGCTGAAGCAAGGTGG - Intergenic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1137525079 16:49228245-49228267 GAGCATGAGCCGAAGCAGGGTGG + Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137557019 16:49477215-49477237 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137570263 16:49560846-49560868 AAAGAAGAGGTGAAGAAGGAGGG - Intronic
1138112693 16:54337224-54337246 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138127670 16:54452316-54452338 GAGTCTGGGCTGAAGATGGATGG - Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138350622 16:56344520-56344542 GAGGATGACCCAGAGAAGGAAGG - Exonic
1138658849 16:58506373-58506395 GAAGATGAGCTGCAGTAAGAGGG - Exonic
1138679553 16:58675102-58675124 GAGGAGGAGCTGGGGAAGAAGGG - Intronic
1138843739 16:60539567-60539589 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1138874725 16:60936128-60936150 GAGCATGAGCTGAAGTAGCAAGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139016765 16:62698786-62698808 GAGTATGACCTGAAGAAGACTGG + Intergenic
1139028268 16:62846576-62846598 GAGGGTGAGTTGAAGAATGGTGG + Intergenic
1139165756 16:64563332-64563354 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1139228284 16:65254590-65254612 CAGGATGAGCTAGAGAACGAAGG - Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139657474 16:68397728-68397750 GAGGAGGAGCTGACCAAGCAAGG - Intronic
1139721525 16:68859792-68859814 GAGGATGAACTGGAGTAGGCAGG + Intronic
1139810880 16:69616185-69616207 GAGCCTGAGCTGAATAAGGAGGG - Intronic
1140141557 16:72263139-72263161 GAGGACGAGCTTACCAAGGAAGG - Intergenic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141050111 16:80753979-80754001 GAGAATGAGCTGCAAAATGATGG + Intronic
1141255249 16:82396233-82396255 GAGGACGAGGTGGAGGAGGAGGG - Intergenic
1141257982 16:82421409-82421431 GAGCCTGAGCTGATTAAGGATGG + Intergenic
1141560959 16:84867492-84867514 GAGGATGAGCTGCAGCAACACGG + Intronic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141932224 16:87213521-87213543 GATGGTGAGGAGAAGAAGGATGG + Intronic
1142220389 16:88851530-88851552 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1142801597 17:2349663-2349685 GCGGAGGAGCTGAAGCAAGATGG + Intronic
1142836148 17:2588731-2588753 GATGCTGAGATGAGGAAGGACGG + Intergenic
1143410107 17:6703548-6703570 GAGGATGAGCAGGAGTAGCAAGG + Intronic
1143749216 17:9016144-9016166 AAGGATGAGATGTAGAAGGTGGG - Intergenic
1143924188 17:10355315-10355337 GAGGAGGAGCTGAGTAGGGAGGG + Intronic
1144184628 17:12785481-12785503 GAGGAGGAGGTGAGGAAGGACGG - Intergenic
1144283011 17:13745468-13745490 GAGGAAGAGCAGGAGATGGAGGG - Intergenic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1145208456 17:20996726-20996748 GAGGAAGAGGTGCAGGAGGAAGG - Intergenic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1145818885 17:27816065-27816087 GGGGATGAGTGGAAGAAGTAGGG + Intronic
1145841710 17:28000576-28000598 GAGGAAGAGAGGAAGAAGAAGGG - Intergenic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1145953221 17:28836453-28836475 GATGCTGAGTTAAAGAAGGAAGG + Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1147124733 17:38358916-38358938 GAAGATGAGCTGAAGTGAGAAGG + Intronic
1147244437 17:39110847-39110869 GACGATGAGCGGAAGAAGCATGG + Intronic
1147349636 17:39830771-39830793 GAGGCTGGGCTGAAGTAGGGAGG + Intronic
1147975762 17:44247366-44247388 TATGATGAGCTGGAAAAGGATGG + Intergenic
1148454157 17:47801938-47801960 GAGAATGAGGACAAGAAGGAAGG - Intergenic
1148474954 17:47922277-47922299 GAGGCTGAGCAGGACAAGGAGGG - Intronic
1148829967 17:50425241-50425263 GAGAAGGAGCTGGAGAAGAATGG - Intergenic
1148859204 17:50595314-50595336 GTGGATGGGCCGGAGAAGGAAGG + Intronic
1148875689 17:50685816-50685838 GAGGAGGAGGAGAAGATGGAGGG - Intronic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149149547 17:53543873-53543895 TAGGGTGAGCTTAAGAATGAGGG - Intergenic
1149192926 17:54085790-54085812 GAAGATGAGCTGAAGCAGGATGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149347149 17:55750809-55750831 AAGGAAGAGCTGGAGAAGTAAGG - Intergenic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1150571558 17:66391378-66391400 GAGGAGGAGCTGTGTAAGGAAGG - Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151362967 17:73599625-73599647 GAGGAAAGGATGAAGAAGGAGGG + Intronic
1151761091 17:76103628-76103650 GAGGACAAGCTGAAGCAGGTGGG - Exonic
1151763717 17:76121730-76121752 GAGGGGGCGCTGAAGAGGGAGGG + Intergenic
1152054966 17:78017405-78017427 GTGGCGGAGCTGAACAAGGAGGG + Intronic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152125454 17:78443989-78444011 AAGGATGGGCTGTTGAAGGAAGG - Intronic
1152309007 17:79537874-79537896 GAGGATGAGCTGATGGGGGTGGG + Intergenic
1152309859 17:79543572-79543594 AAGGAGGAGCTGATGAAGGGGGG - Intergenic
1152435388 17:80273297-80273319 GGGCAGGAGCTGAAGGAGGAAGG + Exonic
1152571178 17:81121933-81121955 GAGGATGAGCTAGAGGAGGTGGG - Exonic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1152913082 17:83016625-83016647 GAGGAGGGACAGAAGAAGGAGGG + Intronic
1152943233 17:83183695-83183717 GAGGAAGAGCAGGGGAAGGAGGG - Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153246083 18:3073792-3073814 GTGGATGAGCTGAAGAGGCCAGG - Intronic
1153313495 18:3700418-3700440 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1153830862 18:8921310-8921332 GACGCTGAGTTAAAGAAGGAAGG - Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154101629 18:11479728-11479750 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1154118624 18:11633472-11633494 GAGGAGGAGGAGAAGAAGAAAGG + Intergenic
1154155028 18:11937276-11937298 GAAGAGGAGAAGAAGAAGGAGGG + Intergenic
1154255079 18:12775619-12775641 GAGAAGGCGCTGGAGAAGGAGGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1154288817 18:13086479-13086501 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1155505857 18:26532102-26532124 GAGGATGGGCTGAATAAGGCAGG + Intronic
1155570202 18:27184849-27184871 GAGGGGGCGCTGGAGAAGGACGG - Intronic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1155663340 18:28277984-28278006 GAGTATGAGTTGGAGAGGGATGG + Intergenic
1155668077 18:28335732-28335754 GAGAATGAGGTGGAGAAGGGTGG - Intergenic
1156398572 18:36720692-36720714 GAGGAGGAGGAGGAGAAGGAGGG - Intronic
1156649483 18:39207876-39207898 GAGGTTGACCGAAAGAAGGAAGG - Intergenic
1157025274 18:43835640-43835662 GAGGGTGAGCTGAAGCGGGGTGG + Intergenic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157210073 18:45734747-45734769 GAGGAGGAGGAGGAGAAGGATGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157492605 18:48135007-48135029 GAGGAGGAGAGGGAGAAGGAAGG - Intronic
1157537632 18:48471733-48471755 GAGAATGCTCTGAAGATGGATGG + Intergenic
1157780615 18:50435399-50435421 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
1158166994 18:54551486-54551508 GAGAAAGAGCTGAAGCAGCAGGG + Intergenic
1159661305 18:71098416-71098438 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1160568775 18:79802572-79802594 GAACCTGAGCTGGAGAAGGAAGG - Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1162121405 19:8471543-8471565 GAGGCAGAGATGAATAAGGAGGG - Intronic
1162338508 19:10076718-10076740 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1162722747 19:12672290-12672312 GAGGAGGAGCTGGAGAATGCAGG + Intronic
1163216744 19:15884822-15884844 GAGGACCAGCTGTAGAATGAAGG - Intronic
1163488249 19:17602212-17602234 GAGGGTGTCCTGAAGAAAGAAGG - Exonic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163779599 19:19239524-19239546 GAAGATGAGTGGAAGGAGGAAGG - Intronic
1163779634 19:19239638-19239660 GAAGATGAGTGGAAGGAGGAGGG - Intronic
1163779809 19:19240283-19240305 GAGGTTGAGGTGGAGAGGGAAGG - Intronic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164217659 19:23163855-23163877 GACACTGAGTTGAAGAAGGAAGG + Intergenic
1164556319 19:29255462-29255484 GAGGGTGAGCTGAAGCATGCTGG - Intergenic
1164612455 19:29641840-29641862 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1164744239 19:30599398-30599420 GAGGAAAAGAGGAAGAAGGAAGG - Intronic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165007261 19:32817445-32817467 GAGGATGAGCTTCAAAGGGAAGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1165905796 19:39193949-39193971 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1166312374 19:41970009-41970031 GAGGAGGAGGTGGAGAAGGATGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166531489 19:43546046-43546068 GAGGATGAGCTGAGGAGGTAGGG - Exonic
1167050103 19:47072646-47072668 GTGGAGGAACTGAAGAAGCAGGG - Exonic
1167285337 19:48596062-48596084 GGGGATGAGCTGGAGGGGGATGG + Intronic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167607842 19:50491035-50491057 GATAATGAGCTGCAGACGGACGG + Intergenic
1167609892 19:50501936-50501958 GAGGAGGTGATGAAGGAGGAGGG - Intergenic
1168170582 19:54585765-54585787 AAGGGCGAGCTGAAGCAGGATGG - Intronic
1168390969 19:56007570-56007592 GAGCAGGAGGTGAAGACGGAGGG + Intronic
1168431074 19:56281220-56281242 TAGGCTGACCAGAAGAAGGAAGG + Intronic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
1168637061 19:58004457-58004479 GAGGATGAGCTGTAGGGGGCTGG - Intronic
1202709247 1_KI270714v1_random:8048-8070 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
926074777 2:9933131-9933153 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927003084 2:18819493-18819515 GAGGATCTGGTGAAGAAGGTTGG + Intergenic
927021407 2:19020787-19020809 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
927117068 2:19916093-19916115 GAGGATGAGCCAAAGCAGGGTGG + Intronic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927302417 2:21530761-21530783 GAGGAAGAGATGGAGAAGAAAGG - Intergenic
927446962 2:23171693-23171715 GAGCATGAGCCAAAGAAGGGTGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927775387 2:25898963-25898985 AAGGTTGAGATGAATAAGGAAGG + Intergenic
927904127 2:26845235-26845257 GAGGACGTGCTGAAGCAGGAAGG + Intergenic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
928891874 2:36213631-36213653 GAGGAGGAGAAGAAGATGGAAGG - Intergenic
929025782 2:37600164-37600186 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929667144 2:43841837-43841859 GAGGAGGCGCTGAGGAAGGAAGG - Intronic
929830016 2:45339594-45339616 GAGGGTGAGCTGCAAAATGAAGG + Intergenic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930893666 2:56421207-56421229 GAGCACGAGCTGAAGCAGGGTGG + Intergenic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930941679 2:57021846-57021868 GAGGGTGAGCCAAAGAAGGGCGG + Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931046822 2:58363149-58363171 GAGGATGAGCTGGAGCAGGGAGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931594462 2:63926657-63926679 GAGGGTGCGCTGAAGCAGGGCGG + Intronic
931804884 2:65794583-65794605 GAGGATGTGGTGAAGGATGAGGG + Intergenic
931975350 2:67637996-67638018 GAGGAGGAGTAGAAGAGGGAGGG + Intergenic
932051613 2:68403847-68403869 GAGGGTGAGCTGAAGCTGGGTGG - Intergenic
932317279 2:70793549-70793571 GAGTGGGAGCTGAAGAAGGGTGG - Intergenic
932327972 2:70876046-70876068 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932539925 2:72641235-72641257 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933413290 2:81951500-81951522 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
933481374 2:82861217-82861239 GAGGAGGAGAAAAAGAAGGAAGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933880387 2:86663829-86663851 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
933881400 2:86673570-86673592 GAGGAGGGCCTGAAGAAGCAGGG - Intronic
933942197 2:87254077-87254099 GATGTTGAGATGAAGCAGGAAGG + Intergenic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934617034 2:95778617-95778639 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
934643859 2:96045942-96045964 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934837276 2:97602036-97602058 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
935325750 2:101935514-101935536 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
935331305 2:101979721-101979743 GAGGAGGTCCTGAAGAAGGTCGG + Intergenic
935515092 2:104026669-104026691 GGGGATGAGGTGAACAGGGAGGG + Intergenic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936005386 2:108882657-108882679 GAGGATGACCTGAAAAGGAAAGG - Intronic
936338028 2:111607493-111607515 GATGTTGAGATGAAGCAGGAAGG - Intergenic
936376068 2:111942453-111942475 CAGGAAGGGCTGAAGAAAGATGG - Intronic
936398480 2:112148359-112148381 GAAGATGAGCTGAAACAGCAGGG + Intronic
936448409 2:112615193-112615215 GAGGCTGAGCGGAAGCAGGGTGG - Intergenic
936717319 2:115203091-115203113 AAGGAAGAGATGAATAAGGAAGG + Intronic
936769610 2:115895377-115895399 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937143047 2:119618432-119618454 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
937160854 2:119759855-119759877 GAAGAGGAGGTGGAGAAGGAGGG + Exonic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937579063 2:123461451-123461473 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938053858 2:128198839-128198861 GAGCTTGAGCTGAAGAAGGGAGG - Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938612965 2:132968266-132968288 GAGAATGGGCTGTGGAAGGAAGG + Intronic
938727669 2:134121425-134121447 GCGGAAGAGCCGAAGAGGGAAGG + Intronic
939055510 2:137360385-137360407 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940048359 2:149434612-149434634 AAGGATGAGTTGACGAAGAAAGG + Intronic
940238287 2:151534484-151534506 GAAGATTACCTGAAGAAGGCTGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940479703 2:154212700-154212722 AAGGATGGGGGGAAGAAGGAGGG - Intronic
940528285 2:154844922-154844944 GAGGGCGAGCTGAAGCAGGCAGG - Intronic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940652602 2:156452722-156452744 GAAGAGGAGCTGATGAAGGTAGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
940964436 2:159821883-159821905 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941069098 2:160936333-160936355 GAGGTTGAACTGAAAAAGAAAGG + Intergenic
941104527 2:161337754-161337776 GATGATGTGCTGTAGCAGGAAGG + Intronic
941179990 2:162247946-162247968 TAGGAGGAGTTGAAGATGGAAGG + Intergenic
941309472 2:163911523-163911545 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941896053 2:170630078-170630100 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
942120746 2:172774222-172774244 GGGAATGAACTGAAGAAGAAAGG - Intronic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942432298 2:175925404-175925426 GAGGAAAAGCTCAAGAAGGCTGG + Exonic
942434594 2:175957729-175957751 GACGATGAGCTGAAGCAGGGCGG + Intronic
942458951 2:176156640-176156662 GAGGGGGCGCGGAAGAAGGAGGG - Intronic
942779883 2:179629688-179629710 GAGGATGAGCCAAAGCAGGGTGG + Intronic
942964592 2:181876324-181876346 GAGGATTAGTGGAAGGAGGAAGG - Intergenic
943112427 2:183622248-183622270 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
943188147 2:184640246-184640268 GAGGAGGAGAAGAAGAAGAAAGG + Intronic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
943660399 2:190554009-190554031 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
943748622 2:191488192-191488214 AAGGATGAGTTGGAGAATGAGGG - Intergenic
944100386 2:196019967-196019989 GAAGAGGAGGTGAAGGAGGAGGG - Intronic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946253184 2:218425871-218425893 GGGGCTGAGCTGAAGAGGCAGGG + Intronic
946324900 2:218980334-218980356 GAGGCCGAGCAGAAGAAAGACGG + Intergenic
946794029 2:223330655-223330677 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947440632 2:230118090-230118112 GAGAGTGAGCTGAAGTGGGACGG - Intergenic
947511033 2:230754457-230754479 GAGTAGGAGGGGAAGAAGGAGGG - Intronic
948160822 2:235822662-235822684 GAGGAGGAGCTGGAGAAGCTTGG + Intronic
948169545 2:235890008-235890030 GGGGAAGAGCTGAAGGAGGCTGG - Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1168798352 20:627411-627433 GAGGATGTGGTGAATGAGGATGG + Intergenic
1169074077 20:2750834-2750856 GAGGTTGACCTGGGGAAGGAAGG + Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169746156 20:8945241-8945263 GAGGGTGTGCTGATGATGGAAGG + Intronic
1169816872 20:9666087-9666109 GTAAATGAGCTGAAGAAGAAGGG + Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170395497 20:15921316-15921338 TAGGATGAGTTGAGGAAAGAGGG - Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171070485 20:22063301-22063323 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1171178218 20:23070965-23070987 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1171519838 20:25767109-25767131 GATGATGAGCTGAAAGAGGGAGG - Intronic
1171557081 20:26089384-26089406 GATGATGAGCTGAAAGAGGGAGG + Intergenic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172518428 20:35551916-35551938 GAGCATGAGCTGAAGCTAGAGGG + Intronic
1172699680 20:36845541-36845563 GAGGGTGAGCTGACAAAGGCAGG + Intronic
1173138322 20:40459731-40459753 TAGGATGAGGAGTAGAAGGAAGG + Intergenic
1173160056 20:40645873-40645895 GAGGAAGAGGAGAAGATGGAAGG + Intergenic
1173165902 20:40687388-40687410 GAGGCTGAGCGAAAGAAGGAAGG - Exonic
1173318728 20:41968476-41968498 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1173517324 20:43673996-43674018 GAGGAGGAGCCGGTGAAGGAAGG + Intronic
1173678242 20:44856962-44856984 GAGGAGGAGGAGAAGAAGAAGGG + Intergenic
1173771843 20:45666395-45666417 GAGGGTGAGCGGAAGCAGGGTGG - Intronic
1174139909 20:48405629-48405651 GTGTATGAGCTCAAGGAGGAAGG - Intergenic
1174224117 20:48982968-48982990 TAGGGTGAGCTGAAGCAGGGCGG - Intronic
1174659287 20:52196991-52197013 GAGGAAGAGCTAAAGAAGAAGGG - Intronic
1174766101 20:53255418-53255440 GAGGAGAAGCTGATGAAAGAGGG + Exonic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175311334 20:58013674-58013696 GGAGCTGAGCTGAAGGAGGAAGG + Intergenic
1175728733 20:61337445-61337467 GATGATGAGGAGAAGAAAGAGGG + Intronic
1175807454 20:61837810-61837832 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
1176300448 21:5096606-5096628 GCTGTTGAGCTGCAGAAGGAGGG - Intergenic
1176653980 21:9573398-9573420 GATGATGAGCTGAAAGAGGGAGG - Intergenic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176870456 21:14079623-14079645 GCAGATGAGCTGAAAAAGGAGGG - Intergenic
1177092064 21:16781678-16781700 GAAGGTGAGCTGAAGCAGGATGG + Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177184275 21:17776037-17776059 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1179085117 21:38209315-38209337 GAGGAAGAGCTCAAGAAAGCTGG - Intronic
1179167528 21:38946534-38946556 GAGGGAGAGATGGAGAAGGAGGG + Intergenic
1179188532 21:39104025-39104047 GAGGAGGAGGAGAAGAAAGAAGG + Intergenic
1179291400 21:40021037-40021059 GAGGCTGAGATGAATAAGGCTGG + Intronic
1179856595 21:44165375-44165397 GCTGTTGAGCTGCAGAAGGAGGG + Intergenic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1180119974 21:45739542-45739564 AAGGATGGGCTGATGAAGAAGGG - Intronic
1180165916 21:46028725-46028747 GAGAAAGTGCTGAAGAATGAGGG - Intergenic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180596152 22:16974857-16974879 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181662280 22:24361020-24361042 AAGGATGAGCTTAATAAAGATGG - Intronic
1182097006 22:27632899-27632921 GAGGCTGAGCTGGAGAAGGCTGG + Intergenic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183032381 22:35115925-35115947 GAGCTTGGTCTGAAGAAGGAAGG - Intergenic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183286574 22:36968744-36968766 TAGGAGGAGGGGAAGAAGGAAGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183752624 22:39730459-39730481 GCAGATGAGCTGAAGCAGGAGGG - Intergenic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
1184291894 22:43501813-43501835 GAGGAGGAGGGGGAGAAGGAGGG - Intronic
1184449692 22:44575669-44575691 GAGGAGGAGAAGAAGAAAGAAGG + Intergenic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1184626703 22:45739121-45739143 TAGGATGTGATGAAGAAGGTGGG + Intronic
1184630029 22:45770017-45770039 GACTAAGAGCTGAAGAAGGGCGG + Intronic
1184689564 22:46111260-46111282 CAGGATGGGCTGTGGAAGGAGGG + Intronic
1184799524 22:46751291-46751313 GAAGAAGAGCTGGAGAAGGAGGG - Intergenic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184985363 22:48129331-48129353 GGGGATGAGGGGAAGAAAGAGGG + Intergenic
1185005917 22:48276997-48277019 GAGGATGGGCTGGAGGAGGCAGG - Intergenic
1185053509 22:48566036-48566058 GATGATGAGCTGATGATGGATGG + Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949449991 3:4174706-4174728 GAGGGTGAGCCAAAGCAGGATGG + Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949706816 3:6827837-6827859 GAGAAAGAGAGGAAGAAGGAAGG - Intronic
949707133 3:6831211-6831233 GAGGAAGAGCTGAGGCATGAGGG - Intronic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949939036 3:9139813-9139835 TAAGATGACCAGAAGAAGGAAGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950891981 3:16412397-16412419 GAGGAAGAGCTGAAGGCAGAAGG + Intronic
950961333 3:17111162-17111184 GTGTGTGGGCTGAAGAAGGAAGG - Intergenic
950969105 3:17168650-17168672 GAGGATGTGCTGGTGGAGGAAGG + Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951006261 3:17618873-17618895 GAGGGTGAGCTGAAGCAAGGCGG - Intronic
951048889 3:18072339-18072361 GAGTATGAGTTGATGAAGGCAGG - Intronic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951469145 3:23036404-23036426 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
952962693 3:38602699-38602721 GAGGATGGCCTGAAGATGCAGGG - Intronic
952990147 3:38824514-38824536 GAGTATGAGGTGAAGTAGAAAGG + Intergenic
953018185 3:39097960-39097982 GAAGATGAGGTGAGGAAGGAAGG - Exonic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953484067 3:43277957-43277979 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
954264493 3:49461853-49461875 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
954501035 3:51014137-51014159 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
954827905 3:53391297-53391319 GAGGATGAGCTGAAACAGGGTGG + Intergenic
955037321 3:55281804-55281826 GAGGAGGAAGTAAAGAAGGAAGG + Intergenic
955234968 3:57131141-57131163 GAGGAACAGCTGAGGTAGGAGGG - Intronic
955563653 3:60221429-60221451 GAGAATGGGCTGTAGGAGGATGG - Intronic
955657918 3:61264111-61264133 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956207803 3:66772117-66772139 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
956211839 3:66809611-66809633 GAGAAAGAGCAGAACAAGGAGGG + Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956316873 3:67947957-67947979 GAGGGTGAGCTGAAGGAGAGCGG + Intergenic
956373287 3:68587116-68587138 GAGGGTGAGCTGAAGCAAGGCGG - Intergenic
956547776 3:70424958-70424980 GAGGAGGAGAAAAAGAAGGAGGG + Intergenic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
956696668 3:71924347-71924369 TAAGATGATCTGCAGAAGGAAGG - Intergenic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958123333 3:89322558-89322580 GAGGACGAGATGTAGAGGGAAGG + Intronic
958157759 3:89776134-89776156 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958434615 3:94081204-94081226 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
958584092 3:96062829-96062851 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
958616054 3:96494430-96494452 GAGGCAGGGCTGAAGGAGGAGGG - Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958694643 3:97511476-97511498 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
958802843 3:98776563-98776585 GAGGAGGAGCTGAGGTAGAAGGG + Intronic
958975959 3:100668079-100668101 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959640580 3:108628181-108628203 GGGGAAGATCTTAAGAAGGAAGG + Intronic
959697519 3:109264497-109264519 GAGGAGGAGAGGAGGAAGGAAGG + Intergenic
959718615 3:109461676-109461698 GAGGAGGAGGAGAAGAAGAAAGG - Intergenic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
959815753 3:110671581-110671603 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960183536 3:114611184-114611206 TTGGTTGAACTGAAGAAGGAAGG + Intronic
960739741 3:120820032-120820054 GAGAAAGAGATGAAGAAGAAGGG - Intergenic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
960836098 3:121908354-121908376 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
960971644 3:123144011-123144033 GAGGATGAGCTGAGGAAGCCAGG + Intronic
961345472 3:126260732-126260754 GAGGAAGGGAAGAAGAAGGAAGG - Intergenic
961984890 3:131121950-131121972 GAGCGTGAGCTGAAGCAGGGCGG - Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962074615 3:132068401-132068423 GATGATGAGGTCATGAAGGAAGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962665963 3:137654052-137654074 GAGGGTGAGCCGAAGAAGGGTGG + Intergenic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962685996 3:137848181-137848203 GAGGATGAGGTGGGGAGGGAGGG - Intergenic
962914140 3:139883414-139883436 GAGGGTGAGCCAAAGCAGGATGG - Intergenic
963265858 3:143239353-143239375 AAGAATGAACGGAAGAAGGAAGG + Intergenic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963460004 3:145600036-145600058 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
964080909 3:152755680-152755702 GAGCAGGAGCTGACGATGGAGGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964718326 3:159746224-159746246 TAGGATGAGGTAGAGAAGGATGG - Intronic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965496173 3:169401654-169401676 AAGAATAAGCTGAAGAAGAAAGG + Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966167169 3:177033128-177033150 AAGGATGCACTGAAAAAGGAAGG + Exonic
966351758 3:179038732-179038754 GAGGACGAACTGAAGCAGGGTGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
967249249 3:187520068-187520090 GAGGAGGAGAAGGAGAAGGAAGG + Intergenic
967458471 3:189718009-189718031 GAGAATGCGCTGATGGAGGAAGG + Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967756823 3:193179532-193179554 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
967864927 3:194182255-194182277 GAAGAAGAGCAGAAGTAGGAGGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968859362 4:3154033-3154055 GAGAATGAGTTGAAGATGGAAGG - Intronic
969617125 4:8260183-8260205 GAGGAGGAGCAGGAGAGGGAAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970496227 4:16628774-16628796 GAGGGTGAGCCGAAGAAGGGTGG + Intronic
970542833 4:17096433-17096455 GAGCATCTGCTGGAGAAGGAAGG - Intergenic
970710670 4:18858712-18858734 GATGATGAGCTGATGAGTGATGG - Intergenic
970792031 4:19868803-19868825 GAGGGTGAGCCGAAGCAGGTTGG - Intergenic
970802529 4:19990989-19991011 GACGATGACCTGAACCAGGATGG - Intergenic
971435755 4:26621417-26621439 GAGGCTATGCTGAAGAATGAAGG - Intronic
971437204 4:26640577-26640599 GAGGGTGAGCCGAAGCAGGGAGG + Intronic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973272920 4:48279759-48279781 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
973567602 4:52204003-52204025 GAGGATAAAGGGAAGAAGGAAGG - Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973798307 4:54451044-54451066 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
973871381 4:55170081-55170103 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
973883501 4:55297300-55297322 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974279938 4:59779963-59779985 GAGGGTGAGCGGAAGCAGGCTGG + Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974528560 4:63077333-63077355 GAGGGTGAGCCGAAGCAGGTTGG - Intergenic
974829557 4:67173449-67173471 GACAATGAGCAGAATAAGGAGGG + Intergenic
974974130 4:68869043-68869065 GAGAAAGAGCTGAAGCAGCAGGG - Intergenic
975054924 4:69918269-69918291 GAGGGTGAGCTGAGGAAGTGAGG - Intergenic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975101921 4:70523369-70523391 GAGGAAGAGTTGAAGTGGGAGGG - Intronic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975247975 4:72142402-72142424 GAGGGTGAGCCAAAGCAGGACGG - Intronic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
975350503 4:73340340-73340362 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
975365003 4:73518808-73518830 GAGGGTGAGCCAAAGTAGGATGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975727204 4:77303560-77303582 GAGGATGAGCCAAAGCAGGGTGG - Intronic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
976215808 4:82714493-82714515 AAGCATGAGCTCATGAAGGAGGG + Intronic
976327416 4:83787749-83787771 GAGGAAGAACTGGGGAAGGATGG + Intergenic
976394823 4:84544798-84544820 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
976506509 4:85853448-85853470 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976561929 4:86511711-86511733 GAGGAGGAGCGGGAGCAGGAGGG + Intronic
976580557 4:86730776-86730798 GAGGATGAGCTGAAGCCGGACGG - Intronic
976585337 4:86791014-86791036 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
976728836 4:88242758-88242780 GAGAAAGAGCTGACGCAGGAAGG + Intergenic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977058288 4:92220959-92220981 GAGGAAGAGGAGAAAAAGGAAGG + Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977495525 4:97770572-97770594 GAGAATGAACTGTAGAAGCAAGG + Intronic
977666440 4:99650918-99650940 GAGGAGGAGGTCAAGGAGGAAGG - Exonic
977771756 4:100868776-100868798 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
978852263 4:113353372-113353394 GAGGATTAGTTGAAGAGGAATGG + Exonic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979377123 4:119960306-119960328 GAGGGTGAGTGGAAGAGGGATGG + Intergenic
979543852 4:121917382-121917404 GAGGGAGAGGTGAAGCAGGAAGG - Intronic
979675351 4:123403277-123403299 AAGCATGGGGTGAAGAAGGAAGG - Exonic
979768383 4:124491105-124491127 GAGGAGGAGGAGAAGAAGAAAGG + Intergenic
979994511 4:127414519-127414541 GTGAATGAGATGATGAAGGATGG - Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
980413570 4:132456120-132456142 GAGGAAGTGATGAAGAACGAAGG + Intergenic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
981064543 4:140468999-140469021 GAGGAGGGGCTGATGAAGCAAGG - Intronic
981199640 4:141965850-141965872 GAGGGTGAGCCAAAGCAGGAAGG + Intergenic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981701357 4:147610478-147610500 GAGTATAAGATGAAGAAGAAGGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981796336 4:148599270-148599292 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
981859932 4:149341829-149341851 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
982364372 4:154559191-154559213 GAGGAGGAGGAGAAGAAGAAGGG - Intergenic
982506243 4:156220649-156220671 AAAGATGAGATGAAGAAGAATGG + Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983362352 4:166743630-166743652 GAGTATGAGCCGAAGCAGGGCGG + Intronic
983594264 4:169448827-169448849 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
983602834 4:169549253-169549275 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
983631189 4:169851248-169851270 AAGGATGATCTGAAGACTGAGGG - Intergenic
983787974 4:171758976-171758998 GAGGGTGAGTTGAAGCAGGGTGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
983881502 4:172938295-172938317 GAGGAGGAGGTGGAGGAGGAGGG + Intronic
983971041 4:173874711-173874733 GAAGAGGAACGGAAGAAGGAAGG + Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984864232 4:184267667-184267689 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
984881616 4:184414444-184414466 GAGGCTGAGGTGTAGGAGGATGG - Intronic
984924527 4:184794925-184794947 GAGGATTTGCTGAAGAGGGACGG + Intronic
985149400 4:186930494-186930516 GAGGATGAGAAGGAGAAGAAGGG - Intergenic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
986009734 5:3701177-3701199 GAGAAGGAGGAGAAGAAGGAGGG - Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986838892 5:11672901-11672923 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
986958623 5:13187281-13187303 GAGCATGAACTAAAGATGGAAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987121355 5:14770599-14770621 GAGGAAGAGATGAAGCAAGATGG + Intronic
987781529 5:22442688-22442710 GAGGATGATCTGAAGTAGGCAGG + Intronic
987910136 5:24132395-24132417 GAGGAGGAGAGGGAGAAGGAGGG + Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988771177 5:34434754-34434776 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
988795152 5:34646674-34646696 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
988969855 5:36456518-36456540 GAGGATGAGATGTTGGAGGAGGG + Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989349957 5:40474727-40474749 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989418198 5:41205397-41205419 GAGTGTGAGCTGAAGAAGGGCGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989519824 5:42388546-42388568 GTGGAGGAGCTGGAGAAGAATGG - Intergenic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
989540318 5:42610606-42610628 GAGAAGGAGCTGCAGAAGGCTGG + Intronic
989675335 5:43966227-43966249 GAGGGTGAGCCAAAGCAGGATGG - Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990408358 5:55514820-55514842 AAAGATAAGATGAAGAAGGAAGG + Intronic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
991105411 5:62837237-62837259 GAGGGTGAGCTGAAGCACGGTGG + Intergenic
991151422 5:63375836-63375858 GAGGGGGAGCTGAAGCAGGGTGG + Intergenic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
991921169 5:71658304-71658326 AAGGATGTGTTGAAGAAGAAGGG - Exonic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992254971 5:74912065-74912087 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992292513 5:75293544-75293566 GAGGGCGAGCTGAAGAAGAGTGG - Intergenic
992483274 5:77171920-77171942 CAGGATGAGGGGAGGAAGGATGG + Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992851679 5:80816361-80816383 AAGGATGAGTGTAAGAAGGAAGG + Intronic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993069057 5:83135189-83135211 GAGCATGAGCCGAAGCAGGGTGG - Intronic
993081189 5:83302486-83302508 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
993149004 5:84135767-84135789 GAGCATGAGTTGATGAAGAAAGG - Intronic
993366755 5:87042993-87043015 GAGGGTGAGCTGAAGCAGGTCGG - Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993628070 5:90249981-90250003 GAGGATGAGAGGAAGAGGTATGG + Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993836001 5:92821217-92821239 GAGGATGAGGTCAAGATGTAAGG + Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
993891612 5:93482296-93482318 GAGGATGAGCCGAAGCAGGTGGG + Intergenic
994005247 5:94829263-94829285 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994039634 5:95244350-95244372 GAGGATGAGCCAAAGCAGGGCGG + Intronic
994138039 5:96309748-96309770 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994142945 5:96361627-96361649 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994240595 5:97415971-97415993 GAGGAAGGGATGAAGGAGGAGGG - Intergenic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994377991 5:99037453-99037475 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
994379916 5:99058625-99058647 GTGAAGGAGCTGAACAAGGAAGG + Intergenic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
994636533 5:102351462-102351484 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
994897179 5:105721404-105721426 GAGTCTGAGCTGAACAAGGGTGG + Intergenic
994913685 5:105945639-105945661 GAGGAGGAGGAGAGGAAGGATGG + Intergenic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
995134967 5:108671193-108671215 GAGGGTGAGCAGAAGAAGTGTGG - Intergenic
995162585 5:108998444-108998466 GAGGGCGAGCCGAAGAAGGATGG - Intronic
995253346 5:110018795-110018817 GGGGCTGAGCTGTGGAAGGATGG + Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995443161 5:112214136-112214158 GAGTCTGAGCTGATGTAGGAGGG - Intronic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995498828 5:112780366-112780388 AAGTATGAGCTTAAGAATGATGG + Intronic
995643014 5:114278841-114278863 GAGGGTGAGCTGAAGTAGGGCGG - Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
996534604 5:124564488-124564510 GAGGATTCGCTAAAGAAGGAAGG - Intergenic
996600342 5:125254947-125254969 GAAGATGAACTGAAGAACCATGG - Intergenic
996670811 5:126114839-126114861 GAGGATGTGCTGAAGACTGATGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997380830 5:133436369-133436391 GAGGATGACCTGTGGCAGGAAGG + Intronic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997596222 5:135109025-135109047 GAGGATAGGCTGGAGAAGGAAGG + Intronic
997682035 5:135763539-135763561 GAGGAGGAGGGGAAGAAAGAGGG + Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
997889186 5:137659990-137660012 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
998772746 5:145564948-145564970 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
998957609 5:147453621-147453643 GAGCCGGAGCAGAAGAAGGAGGG - Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999462621 5:151770671-151770693 GAGGCCGAGCTGAAGGAGCACGG - Exonic
1000024153 5:157344334-157344356 GAGGATGTGATGAAGAATAAAGG - Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000285683 5:159824291-159824313 GAAGATGAAAGGAAGAAGGAAGG + Intergenic
1000412362 5:160947051-160947073 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000934420 5:167291152-167291174 GAGAAAGAGCAGGAGAAGGAAGG - Intronic
1001362757 5:171103898-171103920 GAGGGCGAGCCGAAGAAGGGTGG - Intronic
1001466980 5:171976071-171976093 GAGGAAGGGAGGAAGAAGGAGGG + Intronic
1002161302 5:177315331-177315353 GAGAATGCGCTGAAGGAGGGAGG - Intergenic
1002944713 6:1750428-1750450 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1003022458 6:2522777-2522799 GGGGACGTGGTGAAGAAGGAAGG - Intergenic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003434444 6:6072715-6072737 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1003647463 6:7925842-7925864 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1003856939 6:10286042-10286064 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1003875684 6:10434254-10434276 GAGGAGCAGTCGAAGAAGGAGGG + Intergenic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004293961 6:14393456-14393478 GAGGAGGAGAGGAAGAAAGAAGG + Intergenic
1004637822 6:17485869-17485891 GAGGATGAGGAGGGGAAGGATGG + Intronic
1004698799 6:18059177-18059199 GAGGATGAGCAAGAGGAGGAAGG - Intergenic
1004721220 6:18268926-18268948 GAGTCTGAGCTGAGTAAGGAGGG + Intergenic
1004772334 6:18797839-18797861 GCAGATGAGCTGAAACAGGAAGG + Intergenic
1005027568 6:21478111-21478133 GAGGGGAGGCTGAAGAAGGATGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005647763 6:27857413-27857435 GAAGAAGAGGAGAAGAAGGAAGG + Intronic
1005705334 6:28446047-28446069 GAGGAGGGAATGAAGAAGGAAGG - Intergenic
1005732273 6:28709678-28709700 GAGGAGGACGAGAAGAAGGAAGG - Intergenic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1005950505 6:30627764-30627786 GGGGAAGGGCTGAGGAAGGAAGG - Intronic
1005987372 6:30883536-30883558 GAAGAGGAGCAGGAGAAGGATGG - Intronic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006376338 6:33673577-33673599 GAGGATGAACTGGAGAAGAGAGG - Exonic
1006409768 6:33866158-33866180 GAGGAAGAGAGGAAGAATGAAGG - Intergenic
1006744136 6:36329887-36329909 GAGGAGGAGGAGAGGAAGGAAGG + Intronic
1006798558 6:36745535-36745557 GAGGCTGAGCCCAGGAAGGAAGG + Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007506283 6:42337702-42337724 GGGGAGGAGCTTAAGCAGGAGGG + Intronic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008090202 6:47286027-47286049 GAGGTGGAGCTGGAGAAGGACGG + Exonic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008575558 6:52856853-52856875 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1008865334 6:56203812-56203834 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009290009 6:61869703-61869725 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1009860383 6:69322481-69322503 GAGGTTGTGCAGAAAAAGGAAGG - Intronic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010006148 6:70997839-70997861 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010265018 6:73856271-73856293 GAGGATGCTCTCAGGAAGGAGGG + Intergenic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1010747205 6:79577793-79577815 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1010755724 6:79664138-79664160 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1010961486 6:82151063-82151085 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011348016 6:86392744-86392766 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011417700 6:87139829-87139851 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011480670 6:87790583-87790605 GAGGAAGAGCTGAATGTGGAGGG + Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1011741403 6:90364281-90364303 GAGAATGAGGGGAAGAACGAGGG + Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012585289 6:100914105-100914127 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1012725908 6:102809418-102809440 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
1012799010 6:103801997-103802019 GAGCATGAGCCGAAGCAGGGCGG + Intergenic
1012933194 6:105338564-105338586 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012981971 6:105840669-105840691 CAGGAAGAGCTGTAGAAGGAGGG - Intergenic
1013292067 6:108728304-108728326 GAGCCTGAGCTGGAGAAGCAGGG - Intergenic
1013305921 6:108847078-108847100 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013625759 6:111935254-111935276 GAGGCTGAGCTGAAGCAGTGTGG - Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014074452 6:117220266-117220288 GAGGAGGAGTTGGAGATGGAAGG + Intergenic
1014095671 6:117457917-117457939 GAGGAAGAGATGAAGAAGTAAGG - Intronic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1014296764 6:119627964-119627986 GAGTAGGAGCTGAAGCTGGAAGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014886449 6:126787347-126787369 GAGGATGATGGGAAAAAGGAGGG + Intergenic
1015623484 6:135156631-135156653 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1015801994 6:137069979-137070001 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1015854054 6:137604586-137604608 CAGGATGAGTGGCAGAAGGAAGG + Intergenic
1016006046 6:139090401-139090423 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1016111383 6:140229983-140230005 GAGGGCGAGCCGAAGCAGGATGG + Intergenic
1016114526 6:140263401-140263423 GAACATGAGCAGAAGAAGGAGGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1016542084 6:145177792-145177814 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016832471 6:148447623-148447645 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
1016875911 6:148864468-148864490 GAGCATGAGCCGAAGCAGGGCGG - Intronic
1017032498 6:150236575-150236597 GAGGAGGAGCTGAAAGCGGAGGG + Intronic
1017279602 6:152609139-152609161 GAGGGTGAGCTGACGAAGCAGGG + Intronic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017357454 6:153526327-153526349 GAGGAAGAGCTCAGGAAAGATGG - Intergenic
1017587030 6:155937780-155937802 GAGGATGGGTGGAAGAAGGTTGG + Intergenic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018567558 6:165171006-165171028 GAGGAAGAGGAGGAGAAGGAAGG + Intergenic
1018680677 6:166262470-166262492 GAGGAAGTGCTGAAGAATCAGGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019531685 7:1506557-1506579 GAGGAGGGGGAGAAGAAGGAAGG - Intergenic
1019535334 7:1526319-1526341 GAGGAGGAGAAGAAGAAGAAGGG + Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019827619 7:3297732-3297754 GAGGAGGAGAAGAAGAAGAAGGG + Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020231711 7:6324211-6324233 GAGGGTGAGCTGAGAAAAGAGGG - Intergenic
1020367318 7:7394229-7394251 GAGGGTGAGTTGAAGTAGGGTGG - Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020646420 7:10819710-10819732 GAGGAATAGCTGAAGTAGGAAGG + Intergenic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021071607 7:16248734-16248756 GAGGGCGAGCTGAAGAAGGGTGG + Intronic
1021207772 7:17806802-17806824 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023051841 7:36259139-36259161 GAGGGCGAGCTGAACCAGGATGG - Intronic
1023214454 7:37847256-37847278 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214476 7:37847382-37847404 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214528 7:37847688-37847710 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023586856 7:41739781-41739803 GAGGAGGAGGAGAAAAAGGAGGG + Intergenic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1023967606 7:44971010-44971032 GAGGGTGGGCTGCAGAAGGAGGG - Exonic
1024054903 7:45653726-45653748 GGGTATGAGCAGAAGAAGGTGGG - Intronic
1024253807 7:47524886-47524908 GAGGAGGAGGTAAAGAAGAAAGG + Intronic
1024313893 7:47995306-47995328 GAGGTTGTGATGAAGAAAGATGG + Intronic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025280325 7:57622064-57622086 GATGATGAGCTGAAAGAGGGAGG - Intergenic
1025304408 7:57843437-57843459 GATGATGAGCTGAAAGAGGGAGG + Intergenic
1026137818 7:67678921-67678943 GGGGAGGAGCTGAAGATGGCAGG + Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026217735 7:68364481-68364503 GAAGAAGAGAAGAAGAAGGAGGG - Intergenic
1026245429 7:68615341-68615363 GAAGATGAGGAGAAGAAGGAGGG + Intergenic
1026528376 7:71175541-71175563 GAGGATGAAATAAAGAAGGAAGG + Intronic
1026529516 7:71185022-71185044 GAGGAAGAGAAGAGGAAGGAAGG - Intronic
1026739668 7:72970835-72970857 GAGTAGGAGCTGGAGAAGAAGGG + Intergenic
1026895387 7:74007300-74007322 GAGAATGAGCTGAGGCAGGTGGG - Intergenic
1027104065 7:75394235-75394257 GAGTAGGAGCTGGAGAAGAAGGG - Intergenic
1027338608 7:77181410-77181432 GAGGAGGAGATGAAGAAGGCAGG + Intronic
1027843270 7:83341461-83341483 GAGGGCGAGCTGAAGCAGTATGG + Intergenic
1027864656 7:83630081-83630103 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1027868999 7:83682480-83682502 GAGAATGGGATGAGGAAGGAAGG + Intergenic
1028013635 7:85679804-85679826 GAGGGTGAGCTGAAACAGGGCGG - Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028476416 7:91258172-91258194 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1028648122 7:93120714-93120736 GAGGGTGAGCTGAAGCTGGGTGG + Intergenic
1028652924 7:93170707-93170729 GAGGAGGAGCCGAAGCAGGGTGG - Intergenic
1029306018 7:99620585-99620607 GAGGCTGAACTACAGAAGGACGG - Intronic
1029364327 7:100107389-100107411 GGGGAGGAACTGGAGAAGGATGG + Exonic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029882401 7:103829308-103829330 GAGGAGGAGAGGAGGAAGGAGGG - Intronic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030533952 7:110743633-110743655 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1030612720 7:111706489-111706511 GAGGGTGAGCTGAAGCAGGTTGG - Intergenic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1031031752 7:116743080-116743102 GAGGTTGAGCTGAAGCAAGGTGG + Intronic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031612570 7:123844996-123845018 GAGGGCGAGCTGAAGCAGGCGGG - Intronic
1031785280 7:126022529-126022551 GATGATGAGGTGAGGAAGCAGGG + Intergenic
1031966695 7:128032281-128032303 GAGGAAGAGAGGAGGAAGGAAGG - Intronic
1032312668 7:130802820-130802842 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1032416779 7:131741608-131741630 TGGGAGGAGCTGAGGAAGGATGG - Intergenic
1032515029 7:132500455-132500477 GAGAAGGAGAAGAAGAAGGAGGG + Intronic
1032523129 7:132561358-132561380 GAGGAGGAGGACAAGAAGGAGGG - Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1033205181 7:139414134-139414156 TAGAATGAGGTGAAGAAGGGGGG - Intronic
1033689177 7:143721143-143721165 GGGGATGAGCCTAAGAAGTATGG + Intronic
1033887493 7:145966733-145966755 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1034183409 7:149156079-149156101 GGGGAAGAACTGAAGAAGGGAGG + Intronic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034451300 7:151138605-151138627 GAGGAGGAGCTGCAGAGGGTGGG - Intronic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1034746929 7:153530831-153530853 GAGGGTGAGCTGAAAGAGAATGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034923956 7:155105905-155105927 TACGACGAGGTGAAGAAGGAAGG + Intergenic
1034943203 7:155245222-155245244 GAGGATGAGCTGATGCAGGCAGG - Intergenic
1035074679 7:156169732-156169754 GAGAAGGGGCTGAAGAGGGACGG - Intergenic
1035491172 7:159280004-159280026 GAGGAAGAGGTGGAGAGGGAAGG + Intergenic
1035558876 8:590031-590053 GAGTGTGAGCTGAAGAAGGGCGG - Intergenic
1035667095 8:1387499-1387521 GAGGAGGTTCTGGAGAAGGACGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035796359 8:2360871-2360893 GAGGATGTGGGGAGGAAGGAAGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1036644941 8:10607184-10607206 GAGGATGCTCTGGAGGAGGAAGG + Exonic
1037213803 8:16424888-16424910 GAGGAGGAAGTAAAGAAGGAAGG - Intronic
1037277709 8:17199624-17199646 GAGGAGGAGAAGAAGAAGAAAGG - Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037557679 8:20041289-20041311 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1038276844 8:26128264-26128286 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1038459605 8:27704857-27704879 GAGGCTGAGCTGGAGATGGGAGG + Intergenic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039435984 8:37559560-37559582 GAGGAGGAGGAAAAGAAGGAGGG + Intergenic
1039581394 8:38669708-38669730 GAGCATGGGCTCAGGAAGGATGG - Intergenic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039691307 8:39867675-39867697 GAGAAGGAGAAGAAGAAGGAGGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040354929 8:46608294-46608316 GAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041410173 8:57544913-57544935 GAGGATGGGTTGAGGAAGGAGGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041444223 8:57932050-57932072 GAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1041567733 8:59299489-59299511 GAGGAATAGCTGAAGAAGCTTGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1042056534 8:64769981-64770003 AAAGATGAGATAAAGAAGGATGG - Intronic
1042130488 8:65582761-65582783 GAGGAGGAGATGGAAAAGGAGGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042510494 8:69606235-69606257 GAGGGAGAGCTGTTGAAGGAAGG + Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042651321 8:71045356-71045378 GAGAAAGAGCTGCAGAATGAAGG + Intergenic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044300144 8:90574121-90574143 GGGCATGAGCTGAAGAGGGATGG + Intergenic
1044376064 8:91472586-91472608 GAGGCAGAGGTGGAGAAGGAAGG + Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1044996153 8:97839976-97839998 GAACATGGGCTGAAAAAGGAGGG - Intronic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045111454 8:98941696-98941718 GAGGAGGAGGTGGAGGAGGAGGG - Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045295457 8:100868531-100868553 GAGGATGAGGAGAAGAAAGTGGG - Intergenic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045716713 8:105055666-105055688 GAGGTTGCGATGAAAAAGGAAGG + Intronic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1045975185 8:108123321-108123343 GAGGGAGAGCTGAAGCAGGGTGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046215072 8:111134533-111134555 GAGGAGGAGCGAAGGAAGGAAGG - Intergenic
1046277725 8:111985433-111985455 GAGGGTGAGCCAAAGAAGCACGG + Intergenic
1046671836 8:117064762-117064784 GAGGAGGGGCTGGGGAAGGAGGG - Intronic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046880868 8:119306947-119306969 AAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047039630 8:120978591-120978613 CAGGATGAGATCCAGAAGGAAGG + Intergenic
1047435376 8:124831456-124831478 GAGGATGAGAAGAAGCAGAAAGG - Intergenic
1047520433 8:125591700-125591722 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1047553476 8:125902474-125902496 GAAGATGATCTGAAGAACAAAGG + Intergenic
1048019264 8:130523364-130523386 GAGGAGATGCTCAAGAAGGAAGG - Intergenic
1048263102 8:132962107-132962129 GGTGATGAAGTGAAGAAGGAAGG + Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049196936 8:141320903-141320925 GGGGATGAGTTGCAGAGGGAAGG - Intergenic
1049701310 8:144014414-144014436 GAGGAGGAGAGGAAGAAAGAAGG + Intronic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050234474 9:3563176-3563198 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1050323732 9:4479857-4479879 GAGAATGATGGGAAGAAGGAAGG - Intergenic
1050597263 9:7216405-7216427 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1050693525 9:8254917-8254939 GAAGATGAGATAAAGAAAGAGGG - Intergenic
1051112165 9:13651411-13651433 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051199355 9:14599292-14599314 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052146992 9:25061627-25061649 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052887692 9:33666172-33666194 GAGGGTGAGCTGAACCAGGGCGG + Intergenic
1052988846 9:34506821-34506843 TTGGCTGAGCTGCAGAAGGAGGG - Exonic
1053608245 9:39681685-39681707 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1053866085 9:42438045-42438067 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1054245286 9:62660724-62660746 GAAGGTGAGCTGAAGTAGGGTGG + Intergenic
1054559414 9:66695255-66695277 GAAGGTGAGCTGAAGTAGGGTGG + Intergenic
1054850654 9:69843464-69843486 GAGGAGGAGGAGAAGTAGGAGGG - Intronic
1054874105 9:70077271-70077293 GAGGAAGGGAGGAAGAAGGAGGG - Intronic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055218458 9:73897231-73897253 GAGGATGAGGAGAATTAGGAAGG - Intergenic
1055270007 9:74547310-74547332 AAGGATGAAAGGAAGAAGGATGG + Intronic
1055270982 9:74558210-74558232 GAGGAGCAGCTGCAAAAGGAAGG - Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055642881 9:78334481-78334503 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1055648183 9:78380472-78380494 AAGGAACAGCTGAAGAAAGATGG - Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056003608 9:82243297-82243319 GAAGGTGAGCTGAAGCAGGATGG - Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056513357 9:87327112-87327134 GATGAGGAGGGGAAGAAGGAGGG + Intergenic
1056806586 9:89733518-89733540 GAGGAAGAGGAGGAGAAGGAAGG - Intergenic
1056813164 9:89780196-89780218 ATGGCTGAGCTGTAGAAGGAAGG - Intergenic
1056997864 9:91479948-91479970 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1057082953 9:92186679-92186701 GAGGCAGAGGGGAAGAAGGAAGG - Intergenic
1057498100 9:95575870-95575892 GGAGATGAGTTGAGGAAGGAAGG + Intergenic
1057698186 9:97342147-97342169 GAGGGTGAGCCGAAGAAGGGCGG - Intronic
1057726093 9:97569204-97569226 GTGGAAGCGATGAAGAAGGAAGG - Intronic
1057844791 9:98515059-98515081 GAGAATGAGCCAAGGAAGGATGG + Intronic
1058123996 9:101170848-101170870 GAGGATGACTTGAACCAGGAAGG + Intronic
1058203035 9:102067153-102067175 GAAGGTGAGCTGAAGCAGGGCGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058767344 9:108194647-108194669 GAGAATGAGCTGGAGGAGGCAGG - Intergenic
1058800167 9:108538001-108538023 GAGGATGTGCTGAGGAGGGCTGG - Intergenic
1058868200 9:109180597-109180619 GAGGATGAGCAGAGGTGGGAAGG - Intronic
1058998956 9:110328355-110328377 GGGGATGGGATGAGGAAGGATGG + Intronic
1059352882 9:113678059-113678081 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059611371 9:115900681-115900703 GAGGAGGAGGAGAGGAAGGAGGG - Intergenic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1059957776 9:119536081-119536103 GATGATGAGCTGGAGTGGGATGG + Intergenic
1060283524 9:122228979-122229001 GGGGAGGAGGAGAAGAAGGAGGG - Intronic
1060561611 9:124549514-124549536 GAGGAAGATCTAAAGAAGGGTGG - Intronic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1061865759 9:133491074-133491096 GAGGAGGAGTTGGAGGAGGAGGG + Intergenic
1061967582 9:134025059-134025081 GAGGAGGAGATGGAGGAGGAGGG - Intergenic
1061967647 9:134025284-134025306 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1061967653 9:134025299-134025321 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1203631700 Un_KI270750v1:76850-76872 GATGATGAGCTGAAAGAGGGAGG - Intergenic
1185499055 X:583980-584002 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1185499069 X:584051-584073 GAGGAAGAGAAAAAGAAGGAGGG + Intergenic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185911061 X:3981847-3981869 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1186019132 X:5234836-5234858 GAGGAAGAGGGGAGGAAGGAAGG - Intergenic
1186019153 X:5234911-5234933 GAGGAAGAGAGGAAGAAGGAAGG - Intergenic
1186077597 X:5897964-5897986 GAGGAGGAGAGGAAGAAGGGAGG - Intronic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1186682600 X:11891387-11891409 GAGGAAGAAATGAAGAATGAGGG + Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186908480 X:14136400-14136422 GGGGATGACCTCATGAAGGACGG + Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187551631 X:20311934-20311956 AAGGAAGAGGTGAAGAAGTAAGG - Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187829207 X:23363625-23363647 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
1187840019 X:23477200-23477222 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1188123054 X:26334150-26334172 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189055638 X:37696864-37696886 GAAGAAGGGCTGAAGAAGGAAGG + Intronic
1189081614 X:37978873-37978895 GAGGTTCAGGAGAAGAAGGAAGG + Intronic
1189238130 X:39504367-39504389 GAGAAGGAGATGAAAAAGGAAGG - Intergenic
1189376762 X:40472593-40472615 GAGGAGGGGAGGAAGAAGGACGG - Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189713508 X:43840635-43840657 GAGGATGAGCCTAAGCAGGGTGG + Intronic
1189715373 X:43859489-43859511 GATCATCAGCTGAAGAGGGATGG - Intronic
1189754051 X:44252977-44252999 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1189978506 X:46486361-46486383 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1190405353 X:50081352-50081374 AAGGAGGAGCTGGAGAGGGAGGG - Intronic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1190683451 X:52849531-52849553 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191006215 X:55714088-55714110 GAGGAAGAGGGGTAGAAGGAAGG - Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191073762 X:56430051-56430073 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191168619 X:57418525-57418547 GAGGATGAGCCAAAGCAGGGTGG - Intronic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191705040 X:64085545-64085567 GAGGGTGAGTTGAAGCAGGATGG + Intergenic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191873016 X:65765674-65765696 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191907443 X:66108279-66108301 GAGGGTGAGGTGAAGCAGGGTGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191958050 X:66667606-66667628 GATGAGGAGAAGAAGAAGGAGGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192129063 X:68530761-68530783 GGGGGTGAGCTGAAGCAGGGTGG - Intronic
1192371893 X:70521111-70521133 GAGGGTGAGCTGCTGAAGCAGGG - Intergenic
1192524468 X:71829810-71829832 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1192585059 X:72312875-72312897 GAAGATGAATTGAAGAAGAAGGG + Intergenic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192727469 X:73768066-73768088 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192975060 X:76273990-76274012 GAGGGTGAGTTGAAGCAGGTTGG - Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1192999691 X:76550719-76550741 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193081670 X:77412335-77412357 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1193266772 X:79481847-79481869 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
1193369133 X:80672369-80672391 GAGGCCGAGGTGAGGAAGGAAGG + Exonic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193402567 X:81063841-81063863 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1193477202 X:81981601-81981623 GAGGGCAAGCTGAAGAAGGGTGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193646698 X:84079160-84079182 GAGGGCGAGCTGAAGGAGGGTGG + Intronic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194208586 X:91040470-91040492 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1194254791 X:91622625-91622647 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194961132 X:100236775-100236797 GAGAATGAGCCGAAGCAGGGTGG - Intergenic
1195000626 X:100639831-100639853 GAGAAAGAGGTGAGGAAGGAGGG - Intronic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195508228 X:105684203-105684225 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195842670 X:109191853-109191875 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1195947368 X:110229677-110229699 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196501177 X:116384522-116384544 GAGGTTCAGCTGGAAAAGGAGGG + Intergenic
1196611731 X:117722732-117722754 GAAGATGTGCTGCAGAAGTAGGG - Intergenic
1196960298 X:120993348-120993370 GAGGGCGAGCTGAAGCACGATGG - Intergenic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197308838 X:124878828-124878850 AAGGATGAGCTGCAGAGTGAAGG + Intronic
1197316116 X:124967830-124967852 GAGGATGGGTTGGAGCAGGAAGG - Intergenic
1197537001 X:127702564-127702586 AAGGAAGATCTGAAAAAGGAAGG - Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197682419 X:129400616-129400638 GTGGAAGAGGTGAAAAAGGAAGG + Intergenic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198293737 X:135263788-135263810 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1198402130 X:136278527-136278549 GAGGATGTCATTAAGAAGGACGG + Intergenic
1198402182 X:136278889-136278911 GAGGATGTCATTAAGAAGGAGGG - Intergenic
1198546317 X:137696242-137696264 GAGGCTGAGCTGAAAAATCAGGG + Intergenic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199022997 X:142904469-142904491 GAGGATGACTGGAAGAAGGCTGG + Intergenic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199316564 X:146385433-146385455 GAAAGTGAGCAGAAGAAGGAGGG + Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199436528 X:147819213-147819235 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1199735150 X:150679137-150679159 TGGGATGAGATGGAGAAGGAAGG + Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1200002322 X:153068476-153068498 GAGGAGGAGGTGCAGGAGGAGGG + Intergenic
1200005409 X:153081549-153081571 GAGGAGGAGGTGCAGGAGGAGGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200388581 X:155918603-155918625 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200573577 Y:4862228-4862250 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1201224742 Y:11807898-11807920 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1201314470 Y:12630071-12630093 GAAGGTGAGCTGGAGCAGGATGG - Intergenic
1201353420 Y:13071772-13071794 GAGGGTGAGATGAAGCAGGGTGG + Intergenic
1201393147 Y:13520269-13520291 GAGTGTGAGCTGAAGCAGGCAGG - Intergenic
1201408044 Y:13668634-13668656 GAGAAAAAGCTGAAGAAGCAGGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201671849 Y:16530659-16530681 GAGGAGGAGAAGAAGAAGAAAGG + Intergenic
1201776194 Y:17668552-17668574 GAGTGTGAGCTGAAGAAGGGTGG - Intergenic
1201825362 Y:18237440-18237462 GAGTGTGAGCTGAAGAAGGGTGG + Intergenic
1201907433 Y:19100177-19100199 AAGGAGGAGCTAAAGAAGAAAGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic