ID: 1012262568

View in Genome Browser
Species Human (GRCh38)
Location 6:97104684-97104706
Sequence CTTGTAAGACAGATCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012262568_1012262570 13 Left 1012262568 6:97104684-97104706 CCTTGAAAGATCTGTCTTACAAG 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1012262570 6:97104720-97104742 CAGTTTTAATTATAGCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012262568 Original CRISPR CTTGTAAGACAGATCTTTCA AGG (reversed) Intronic
904505984 1:30954470-30954492 CTTCAAAGACAGCTTTTTCATGG - Intronic
910538746 1:88330725-88330747 CTTAAAAGACAGATCTATAAGGG + Intergenic
910720847 1:90284822-90284844 ATTGCAAAACACATCTTTCAGGG + Intergenic
914338675 1:146739665-146739687 CTTTTAAAACAGGACTTTCAGGG - Intergenic
917429463 1:174950968-174950990 CTTGTAAGAGCTATCATTCAGGG - Intronic
919543640 1:198883561-198883583 CTTCAAATCCAGATCTTTCAGGG - Intergenic
919937417 1:202263878-202263900 CTGGTAAGACAGTCATTTCAGGG + Intronic
919988679 1:202693624-202693646 TTTGGAATAAAGATCTTTCAAGG + Intronic
920856295 1:209665178-209665200 CTTGTAAGACACTTTCTTCATGG - Intergenic
922886679 1:229025640-229025662 CTTCTGAGACAGATGTTTCTGGG - Intergenic
924123674 1:240827966-240827988 CTTGTAAGACAGTTCATTCTGGG - Intronic
924698100 1:246420920-246420942 TTTATAAGACAGATCTTTCTAGG + Intronic
1065555895 10:26915357-26915379 CTGGTAAGACAGATCATTTAGGG + Intergenic
1066302867 10:34112125-34112147 CTTGAAAGCCAGAGCTTTAAGGG - Intronic
1067420607 10:46142263-46142285 CATGGAAGACAGTTTTTTCATGG - Intergenic
1067425414 10:46207270-46207292 CATGGAAGACAGTTTTTTCATGG + Intergenic
1067505949 10:46848729-46848751 CATGGAAGACAGTTTTTTCATGG - Intergenic
1070283387 10:75066637-75066659 CTTCTAAAATAGAACTTTCATGG - Intergenic
1072248789 10:93565876-93565898 CAAGGAAGACAGATATTTCAAGG - Intergenic
1073281676 10:102359181-102359203 CTTGGAAGACAGCTACTTCAGGG + Intronic
1073303669 10:102486324-102486346 CTTGGAAGACAGTTTTTCCATGG - Intronic
1073732276 10:106303518-106303540 CTTGCAAGACAGCTGTTTCATGG + Intergenic
1075251979 10:120887216-120887238 ATTGTAAGTCAAATCCTTCAGGG - Intronic
1075873479 10:125788069-125788091 CCTTTCAGCCAGATCTTTCAAGG + Intronic
1078303439 11:10157766-10157788 CATGGAAGACAGTTTTTTCATGG - Intronic
1079803532 11:24900279-24900301 CTTGTAAGACAGGCCTTTCTAGG + Intronic
1080299329 11:30767221-30767243 AATGTAGGACAGATGTTTCAAGG + Intergenic
1081247787 11:40790669-40790691 TCTGTAAAACATATCTTTCAGGG + Intronic
1081341965 11:41939126-41939148 CATGTAAAACAAAGCTTTCATGG + Intergenic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1086372015 11:86164462-86164484 CTTGTAAGACAGACCTTAGAGGG - Intergenic
1086564555 11:88211320-88211342 CTTATAACACACATCTTACATGG + Intergenic
1087899313 11:103622813-103622835 CTGCTTAGATAGATCTTTCAAGG - Intergenic
1089834710 11:121359841-121359863 CTGGTAAGACAGATCCTGAAAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091215667 11:133899884-133899906 CCTGCAAGAAAGATCATTCAAGG + Intergenic
1091933771 12:4418113-4418135 CTTCTCAGACAGACCTTACAAGG + Intergenic
1092093020 12:5819693-5819715 CTTGTAAAACAGATTTGTGAGGG + Intronic
1093423947 12:19006733-19006755 CTTGCAAGACAGATGTTTGAGGG - Intergenic
1094360551 12:29626003-29626025 CTTGTAAGACATATATCTAAAGG - Intronic
1095135886 12:38602598-38602620 CTTCTATGACAGAAATTTCAAGG - Intergenic
1096264259 12:50111053-50111075 CTGGTAAGACAGAATTCTCAAGG - Exonic
1105766944 13:23569363-23569385 ATTTTCAGACAGTTCTTTCATGG - Intergenic
1107416226 13:40203332-40203354 CTTAACAGTCAGATCTTTCATGG - Intergenic
1108129152 13:47278658-47278680 CTTGGAAGAAATATCTTCCAAGG + Intergenic
1108558908 13:51623998-51624020 CTTCCAAGACAGCTCTTTAAAGG - Intronic
1108842037 13:54630261-54630283 CTTGTGAGAGAAATCTTACAAGG - Intergenic
1110585200 13:77182491-77182513 TTTGTAACACAGATGTTTGAAGG - Intronic
1111682981 13:91466765-91466787 CTTGCAAGAGAGTACTTTCAGGG + Intronic
1115457283 14:33618180-33618202 CATGGAAGACAGTTTTTTCATGG + Intronic
1115505986 14:34094654-34094676 CTGGGAAGACATATCTTTTAGGG - Intronic
1116531697 14:45980138-45980160 CTTGTAAAACAGATTTGTGAGGG - Intergenic
1118147386 14:63154810-63154832 CTTGTAAAACATATCTATGAAGG - Intergenic
1120006032 14:79358855-79358877 CTTTTAAGTCACATCTTTAAGGG - Intronic
1121506350 14:94480398-94480420 ATAGTAATACTGATCTTTCAGGG - Intergenic
1125841087 15:42801753-42801775 CTTGGCAGTCAGCTCTTTCAGGG + Intronic
1125936884 15:43644751-43644773 CTTGCAAGACAGTTTTTCCATGG - Intronic
1125949692 15:43741538-43741560 CTTGGAAGACAGTTTTTCCATGG - Intergenic
1131956879 15:97746388-97746410 ATTGGTAGACAGATCTTACAGGG - Intergenic
1136156017 16:28382703-28382725 TTTGAAAGACAGATCCTGCAGGG - Intronic
1136207069 16:28732585-28732607 TTTGAAAGACAGATCCTGCAGGG + Intronic
1137511681 16:49106234-49106256 CTTGTAAAGCAGATTTGTCAAGG + Intergenic
1138839256 16:60478739-60478761 CTTGTAACAGAAATCTCTCATGG - Intergenic
1138871927 16:60900706-60900728 CTTGCAAGTGAGATCTTTCAGGG + Intergenic
1139995601 16:70977689-70977711 CTTTTAAAACAGGACTTTCAGGG + Intronic
1141056730 16:80823283-80823305 CATGGAAGACAGTTTTTTCATGG - Intergenic
1143195273 17:5071545-5071567 CTTGGATGACAGATCCTTCTTGG - Intergenic
1143855160 17:9842950-9842972 CTTCAAAGAGAGATCTTCCAGGG + Intronic
1146234881 17:31149833-31149855 TTTGTAAGACAAACCTTACATGG - Intronic
1146738123 17:35257112-35257134 CTTGGAAGACAATTTTTTCACGG - Intronic
1148756976 17:49978327-49978349 CTTGAAAGCCAGCTCCTTCATGG - Intergenic
1153182789 18:2454635-2454657 CTTGGCAGACAGAATTTTCATGG - Intergenic
1153314528 18:3708891-3708913 CTTTAAAAACAGATTTTTCAGGG + Intronic
1155703996 18:28784585-28784607 CATGTAAGTGAGATCTTTCGTGG - Intergenic
1156542083 18:37923828-37923850 ATTTTAAAACAGATCTGTCAGGG - Intergenic
1157230972 18:45915723-45915745 CTGATAAGACAGAGATTTCAAGG + Intronic
1157367360 18:47077627-47077649 CTGTTAAGGCAGATCTTTCGTGG - Intronic
1158763086 18:60413962-60413984 CTTGGAAGACAGTTTTTCCATGG + Intergenic
1159193126 18:65074448-65074470 CTTCTAAGGAAGATCTTTCAAGG - Intergenic
925496797 2:4459998-4460020 TTGGTAAAACAGATATTTCATGG + Intergenic
927650017 2:24906814-24906836 CTTATAAGACAGATTGCTCAAGG - Intronic
937109785 2:119355752-119355774 CATGGAAGACAGTTTTTTCATGG - Intronic
937568592 2:123328933-123328955 CCTGGAAGACAGTTTTTTCATGG - Intergenic
937772870 2:125742455-125742477 CTTGTGAGAAAAATCTGTCAAGG + Intergenic
938928071 2:136062424-136062446 CTTCTAAAACAGCTCCTTCAAGG + Intergenic
941656118 2:168146539-168146561 CTTGTAGGAAAGAACTCTCAGGG - Intronic
942068385 2:172293437-172293459 CATGTAAGACAGATCTATTGTGG + Intergenic
942702464 2:178729274-178729296 CTTGTATAACTGACCTTTCAGGG + Exonic
942798847 2:179852784-179852806 CTAGTGAGTCAGAGCTTTCAAGG + Intronic
944161190 2:196662360-196662382 CTTGGAAGACAGTTTTTCCATGG + Intronic
944867651 2:203878399-203878421 ATTGTAAGAAATATATTTCAGGG + Intergenic
945889964 2:215419990-215420012 CTGGTAACACAGCTCTTTTAAGG + Intronic
946806427 2:223475270-223475292 CATGGAAGACAGTTCTTCCATGG - Intergenic
947871071 2:233438388-233438410 CTTGTAAAATATATCTTTCTTGG + Intronic
1171047190 20:21821279-21821301 TCTGTAAGAGAGATCTTTTAGGG + Intergenic
1173047120 20:39523174-39523196 CTTGTAAGTCAGTTCTTCCATGG + Intergenic
1174394838 20:50240597-50240619 CTTCTAAGAGAGATCCTTCTGGG - Intergenic
1175574414 20:60050071-60050093 ATTATAATGCAGATCTTTCAAGG + Intergenic
1175614189 20:60378852-60378874 CTTGTAAGAAGGGTCTTCCAGGG - Intergenic
1177084209 21:16681792-16681814 CTTGGAAATCATATCTTTCAAGG + Intergenic
1183154766 22:36066422-36066444 CATGTAAGGGAGATCTTACAGGG - Intergenic
1183271660 22:36866098-36866120 CTTGTAAGAATGCTGTTTCATGG - Intronic
951485675 3:23206719-23206741 GTTGTAACACCGATCTTTAATGG - Intronic
951664839 3:25111420-25111442 CTAGTAAGAGAGAAATTTCAAGG - Intergenic
955328176 3:58025634-58025656 CCTGTAAGACAGAGCATTTAAGG - Intronic
955452892 3:59089307-59089329 TTTGTCAGACAGATCTATCAAGG + Intergenic
956070703 3:65447864-65447886 GTTGTAAGACTGACCTTTCCTGG + Intronic
956448749 3:69352143-69352165 CTTGTTATGCAGCTCTTTCAGGG - Intronic
957584889 3:82120681-82120703 CCTGGAAGACAGTTTTTTCACGG + Intergenic
957755139 3:84475512-84475534 CTTGGAAGACAAATTTTCCATGG + Intergenic
958643259 3:96836426-96836448 CTTGTAAAATAGAACCTTCAAGG - Intronic
958981050 3:100720477-100720499 CGTGTAAGACAGTTCTTCTATGG + Intronic
966007989 3:175040057-175040079 CTTGTAAGAGAGATCTTGGCTGG - Intronic
967106339 3:186257598-186257620 CCTGTAAAGCAGATCTGTCATGG - Intronic
970395956 4:15666058-15666080 CTTGTAATACAAACCTTTTAGGG + Intronic
970510083 4:16773245-16773267 CGTGGAAGACAGGTTTTTCACGG + Intronic
972635549 4:40880944-40880966 ATTTTCAGACAGATCGTTCATGG - Intronic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
973583346 4:52366701-52366723 CTTGTAAAATAGATCTTTCCAGG - Intergenic
974003793 4:56535892-56535914 CGTGGAAGACAGTTTTTTCAAGG + Intronic
974149531 4:57989019-57989041 TTTGAAAGACAGATCTGTCAGGG + Intergenic
974636610 4:64571964-64571986 TTTATATGACAGATCTGTCAAGG + Intergenic
975301438 4:72795702-72795724 CTTGGAAGACAGTTCTTCCATGG - Intergenic
975833528 4:78396404-78396426 CTTGTAAGACAGGACTTTAGTGG + Intronic
977234308 4:94488876-94488898 CCTGTAAGGCAGATCCTTTACGG - Intronic
978274565 4:106934748-106934770 TTTGAAAGACTGTTCTTTCATGG + Intronic
979420251 4:120495318-120495340 CTTAAAAGACAGATATTTCTAGG - Intergenic
981875320 4:149536050-149536072 ATGATAAGACAAATCTTTCAGGG + Intergenic
981913572 4:150009877-150009899 TTTGAAAGTCAGATCTTTTAAGG - Intergenic
982812163 4:159839540-159839562 TTTAGAAGACAGCTCTTTCAGGG + Intergenic
984000536 4:174236110-174236132 GTTGTACTACAGATTTTTCAAGG - Intergenic
984764092 4:183386259-183386281 CTTATAACAAAGATCTGTCATGG - Intergenic
986332618 5:6728483-6728505 CTTGTAGGATAGCTTTTTCAGGG + Intronic
988348795 5:30073656-30073678 CTTGTAAGGCAGGTCTTGTAAGG - Intergenic
993456708 5:88135591-88135613 CTTATAAGACAGATTGTTAAAGG - Intergenic
995704840 5:114977519-114977541 CTTGTAAGCCAGATGTTAAAGGG + Intergenic
1001894496 5:175366788-175366810 CATGGAAGACAGATTTTCCATGG - Intergenic
1005354884 6:24972833-24972855 TTAGTAAAACAGATTTTTCAAGG - Intronic
1005598462 6:27402303-27402325 CTTGGAAGATTGATCTCTCAAGG + Exonic
1009058537 6:58369019-58369041 CTTGTAAGTCAGATCTGATAGGG - Intergenic
1009232302 6:61078101-61078123 CTTGTAAGACGGATCTGATAGGG + Intergenic
1009519468 6:64663486-64663508 CTTATAAGACAAAGCTATCACGG + Intronic
1009875005 6:69494888-69494910 CTTGTAAGATGGGTCTTACAAGG - Intergenic
1010931367 6:81807660-81807682 CTTTTAAGACATATTTTTCTTGG - Intergenic
1012262568 6:97104684-97104706 CTTGTAAGACAGATCTTTCAAGG - Intronic
1013889979 6:115014663-115014685 ATTGTAAGACTTATCTTTAAAGG + Intergenic
1014803828 6:125807149-125807171 CTTGATAGACAGATCTTCAAGGG - Intronic
1015870857 6:137774915-137774937 ATTGGAAGACAGAGCTTTCTGGG - Intergenic
1016420237 6:143875243-143875265 CTTGTAAAACAGATTTGTGAGGG - Intronic
1018159934 6:161029612-161029634 CAAGTAAGACAAATGTTTCAGGG + Intronic
1021324829 7:19253946-19253968 CTTTGATCACAGATCTTTCAAGG + Intergenic
1021330730 7:19335928-19335950 CTTGTAAGACGGATATTCAAAGG - Intergenic
1022078639 7:26998383-26998405 TTTGTGAAACAGATTTTTCAGGG + Intergenic
1023738327 7:43254467-43254489 CTAGTAAGTCAGATATTTCCAGG - Intronic
1024134776 7:46395331-46395353 CTTGAAAGTGATATCTTTCAGGG + Intergenic
1026679680 7:72456220-72456242 ATTGTAAGAGGGATCCTTCATGG + Intergenic
1030985171 7:116233010-116233032 CATGTCAGACTGATCTTTCAAGG + Intronic
1031100029 7:117468612-117468634 GGTGGAAGACAGATTTTTCACGG - Intronic
1031969301 7:128052528-128052550 CTTGGAAGACAGCTCTGTCTGGG - Intronic
1032298244 7:130662185-130662207 CCTGTAAGGCAGCTGTTTCAGGG - Intronic
1032494843 7:132353556-132353578 CTTGCCAAACAGATATTTCAAGG - Intronic
1032531666 7:132625890-132625912 CTTGTAGGAAATATATTTCAGGG + Intronic
1036920283 8:12847118-12847140 TTTGTAAGTCACATCTTTCTAGG + Intergenic
1039927738 8:41953164-41953186 CTTTTAAGATAGATATTTAAAGG - Intronic
1042710356 8:71710204-71710226 CTTGTAAAACACATTTTTCTGGG - Intergenic
1042986402 8:74588553-74588575 CTTATAGGAGATATCTTTCATGG - Intergenic
1045525268 8:102936075-102936097 ATTGCAAGACAGCTCCTTCACGG - Intronic
1046928350 8:119817477-119817499 CTTGGAAGACAGTTTTTCCACGG - Intronic
1048609319 8:136004729-136004751 AATGGAAGACAGATTTTTCATGG + Intergenic
1053048361 9:34938197-34938219 CTTATAAAACAGAACTTTCAAGG + Intergenic
1053442233 9:38125986-38126008 CTTAGAAGACAAATCTGTCAAGG - Intergenic
1058190930 9:101914871-101914893 CATGGAAGACAGTTTTTTCATGG + Intergenic
1060053775 9:120395742-120395764 CTTTTAATACACATATTTCATGG - Intronic
1187267977 X:17754571-17754593 TTTGTAAGTTAGAACTTTCAAGG + Intronic
1189654919 X:43234958-43234980 CAGGGAAAACAGATCTTTCACGG + Intergenic
1189705263 X:43753148-43753170 TTTTTAAGGCAGATCTTGCAAGG + Intergenic
1191899777 X:66028818-66028840 CTTTTGAGTCAGGTCTTTCAGGG - Intronic
1195055681 X:101142206-101142228 ATTGTAAGGCAGCTATTTCAGGG - Intronic
1197050302 X:122048921-122048943 CTTGTAAGAGACATCTTGAAAGG - Intergenic
1201858468 Y:18570504-18570526 TTTGTAAGACAATTCTATCAAGG - Intronic
1201874853 Y:18749877-18749899 TTTGTAAGACAATTCTATCAAGG + Intronic
1201967383 Y:19753315-19753337 CTTCTGAGACAAAACTTTCAGGG - Intergenic