ID: 1012262882

View in Genome Browser
Species Human (GRCh38)
Location 6:97108484-97108506
Sequence CAGGATTCCCTCCACCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012262876_1012262882 17 Left 1012262876 6:97108444-97108466 CCTCTTACTGTAGTAGTCTTTAA 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG 0: 1
1: 0
2: 2
3: 17
4: 180
1012262880_1012262882 -9 Left 1012262880 6:97108470-97108492 CCTTAAATGGGCTCCAGGATTCC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG 0: 1
1: 0
2: 2
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012262882 Original CRISPR CAGGATTCCCTCCACCAGCA TGG Intronic
900587867 1:3442088-3442110 CCGGACCCCTTCCACCAGCAGGG - Intergenic
900754609 1:4424937-4424959 CAGGTTTCTCTCCACGTGCATGG + Intergenic
902472458 1:16658292-16658314 CAGCTGTCCCTCCACCAGCCGGG - Intergenic
902486346 1:16749154-16749176 CAGCTGTCCCTCCACCAGCCGGG + Intronic
905662542 1:39738673-39738695 AAGGTTTCCCTCCCCCAACACGG + Intronic
907615977 1:55927123-55927145 GTGGCTGCCCTCCACCAGCAAGG - Intergenic
908755408 1:67464982-67465004 CAAGAAGCCCTCCACCAGCCTGG + Intergenic
911061270 1:93750212-93750234 CAGGACTGCCTCCTTCAGCAAGG + Intronic
914377457 1:147084889-147084911 CTGGACTCCCTCCCACAGCACGG + Intergenic
915737834 1:158095785-158095807 CAGGAATCCCCCCGGCAGCACGG + Intronic
915915847 1:159940439-159940461 GAGGCCTCCCTCCACCTGCAGGG + Intronic
916810447 1:168301023-168301045 GAGGATTCCCTCCACCATCCTGG - Intronic
918521665 1:185421375-185421397 CTGGATTCCTTCCCCTAGCATGG + Intergenic
922572828 1:226644003-226644025 CAGGAGTCCCTCCCACAGCCTGG - Intronic
923984252 1:239362776-239362798 CTGCATTCACTTCACCAGCAAGG + Intergenic
1063216141 10:3927299-3927321 TGGGATTCCCTTCAGCAGCAGGG + Intergenic
1063851883 10:10201353-10201375 CAGGAGCCCCTTCATCAGCAAGG + Intergenic
1064927203 10:20582233-20582255 GTGGCTGCCCTCCACCAGCAAGG - Intergenic
1068598000 10:58924676-58924698 CAGAATTCCCTCCTCCTCCAGGG - Intergenic
1068681307 10:59823217-59823239 TCGGCTGCCCTCCACCAGCAAGG - Intronic
1069823228 10:71240121-71240143 CGGGACTCCCTCCTGCAGCAGGG - Intronic
1072306337 10:94111235-94111257 CAGGGTTCCTTCCAGCTGCAGGG + Intronic
1073367738 10:102957640-102957662 CAGGATTCCTTCCACGTCCAAGG + Intronic
1073514962 10:104068050-104068072 CAGACTCCCCTCCGCCAGCAGGG - Intronic
1075057868 10:119233415-119233437 CAAGTTTCCCTCCACCAGCTTGG - Intronic
1075761837 10:124863431-124863453 CAGGCTTCTTTCCAACAGCAGGG - Intergenic
1076076246 10:127535971-127535993 CAGGAATCCCTCCACCAGGACGG - Intergenic
1076319091 10:129564911-129564933 CAGGGTCCCTTCCTCCAGCATGG + Intronic
1076346163 10:129780229-129780251 CTGGCTTGCCTCAACCAGCATGG + Intergenic
1077233531 11:1469192-1469214 GAGGGTCCCCGCCACCAGCACGG + Intergenic
1080558155 11:33436475-33436497 CAGACTGCCCTCCCCCAGCAGGG - Intergenic
1080641274 11:34159947-34159969 CAGCTTTCCTTCCACCAGGAAGG + Exonic
1081749632 11:45500727-45500749 CAAGGGTCCCTCCACCAGCCAGG + Intergenic
1083013168 11:59423511-59423533 CTGGATTTCCTCCACCAAAATGG - Intergenic
1083169246 11:60913052-60913074 GCGGTTGCCCTCCACCAGCAAGG + Intergenic
1083189229 11:61037272-61037294 CAGGATTTCGTGCACCTGCATGG - Intergenic
1084758944 11:71256194-71256216 CAGGATGCCCTGCACCCCCAAGG - Intergenic
1087216615 11:95502013-95502035 CTGGAGTCCCTCCACCAGCACGG - Intergenic
1088305434 11:108402266-108402288 AAGGGTTCCCTACACCAACAAGG + Intronic
1088692496 11:112339630-112339652 AAGGGTTCCTTCCAACAGCAGGG - Intergenic
1090764995 11:129868818-129868840 CAGGATTATCGCGACCAGCATGG + Intronic
1090765760 11:129874659-129874681 CAGGATTCAGTCCACTGGCAAGG - Intronic
1090893229 11:130946147-130946169 CAGGATGCTCTCCCACAGCAGGG - Intergenic
1091820415 12:3471589-3471611 CTGGGCTCCCTCAACCAGCATGG + Intronic
1093413021 12:18888926-18888948 CAGGGTTGCATCCTCCAGCAGGG - Intergenic
1093925113 12:24902342-24902364 AACCATTTCCTCCACCAGCAGGG + Intronic
1094230080 12:28092789-28092811 AAGGATTCATACCACCAGCAGGG + Intergenic
1096121326 12:49091262-49091284 CAGGATTCACTCCACTACGAAGG - Exonic
1096255336 12:50058748-50058770 CAGGATCCCCTCAACAAGGATGG + Exonic
1103782505 12:123408400-123408422 CAGGAAACCCTGCCCCAGCAGGG - Exonic
1103910552 12:124349803-124349825 CAGGCTTCCCGCCACCCCCAGGG + Intronic
1104745325 12:131206938-131206960 CAGGACTCCCGCCAGCAGCTGGG + Intergenic
1104789014 12:131470168-131470190 CAGGACTCCCGCCAGCAGCTGGG - Intergenic
1105217783 13:18299429-18299451 CAGGAAACCCTGCCCCAGCAGGG - Intergenic
1105302675 13:19150298-19150320 CCGGTTTCCCACCACCAGCTGGG + Intergenic
1107659436 13:42624037-42624059 CTGGTTTCCCTCTTCCAGCAAGG + Intergenic
1117375993 14:55118680-55118702 CAGGAATCAATCCACCACCAAGG - Intergenic
1120136667 14:80878095-80878117 CAGCAGCCCCTCCCCCAGCAGGG + Intronic
1121098693 14:91234940-91234962 CGGGAAGCCCACCACCAGCACGG + Exonic
1121742809 14:96266071-96266093 CAGGATGCCCGCCACCATCAGGG + Intronic
1123016980 14:105380394-105380416 CTGGACTCCCCCCACCCGCAGGG + Intronic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1127760140 15:62131654-62131676 CAGGCTTCTGTCAACCAGCAAGG - Intergenic
1128980727 15:72183938-72183960 CAGGTCTCTGTCCACCAGCAAGG + Intronic
1129768424 15:78185335-78185357 CATGTTTCCCCCCACCAGCATGG + Intronic
1130371155 15:83285683-83285705 AAGGATCCCCACCAGCAGCAAGG - Intergenic
1131843035 15:96458431-96458453 CTGGCTTCCCATCACCAGCAGGG + Intergenic
1132701275 16:1223129-1223151 CAGCATGCCCGACACCAGCAGGG + Intronic
1132727895 16:1346657-1346679 CAGGTTCCCCTTCACCAGCGAGG - Exonic
1133681180 16:8121638-8121660 CCGGATTCCCTCCACCTCCTGGG + Intergenic
1134459799 16:14421286-14421308 CAGGCTTGCCTCCACCATGATGG + Intergenic
1135890719 16:26354667-26354689 CAGAAAACCCTACACCAGCATGG + Intergenic
1136612245 16:31373257-31373279 CAGGTTACTCCCCACCAGCAGGG - Exonic
1138146113 16:54613116-54613138 GAGGACTCCCTCCACCAACATGG + Intergenic
1138166460 16:54806313-54806335 CAGGATGCCAGCCACCAGCTTGG - Intergenic
1138337414 16:56264084-56264106 AAGGACTTCCTCCACCACCAAGG + Intronic
1138629120 16:58279559-58279581 CAGGGTTGCCTGCACCATCACGG + Intronic
1139469688 16:67171473-67171495 CCAGCTTCCCTCCACCAGCCAGG - Intronic
1139482000 16:67235946-67235968 CAGCATTGCTTCCCCCAGCAGGG - Intronic
1139824502 16:69746350-69746372 CAGGCCACACTCCACCAGCAAGG + Intronic
1140550125 16:75856441-75856463 GTGGCTGCCCTCCACCAGCAAGG - Intergenic
1143156984 17:4843865-4843887 CAGGTCTCCCTCCAACAGCATGG - Intronic
1143292386 17:5841108-5841130 CAGCATGCTCTCCACGAGCAGGG + Intronic
1148858510 17:50592064-50592086 CTGGAAGCCCTCCACCAGAATGG - Exonic
1148979516 17:51560215-51560237 CATGATTCAATCCACCATCAAGG - Intergenic
1149775851 17:59356482-59356504 CTGGATTCTTTCCACCACCATGG - Intronic
1152205917 17:78974303-78974325 CGGGACTCCCTCCGCCAGGACGG + Intronic
1153084714 18:1271335-1271357 CAGCATTGCCTCCCACAGCAAGG + Intergenic
1158987247 18:62830561-62830583 CAGGTTTCCCACCATCAGTAAGG + Intronic
1161352524 19:3801890-3801912 CAGGATTCCTGCCACCAGGTGGG - Intronic
1161637193 19:5396362-5396384 CAGGATTCCCCTCACTAGTAGGG - Intergenic
1162633044 19:11943994-11944016 CGGGATTCCCTCTACCTTCACGG + Intronic
1165306510 19:35005956-35005978 TGGGATTCCCTCCACCACCTGGG - Intronic
1167443765 19:49525475-49525497 GACGATTCCCACCACGAGCACGG - Exonic
1168386668 19:55969032-55969054 CAGGACTCCCTCTTCCAGAATGG + Intronic
1168636299 19:57999853-57999875 CAGGCTTCCCTCCACGTGCCAGG + Exonic
1202704853 1_KI270713v1_random:15114-15136 CAGCTGTCCCTCCACCAGCCGGG - Intergenic
926693042 2:15750580-15750602 CTGTTTTCCCTCCCCCAGCAAGG + Intergenic
928920307 2:36520114-36520136 CAGGTTTCCTTCCACCAGGCAGG - Intronic
928997006 2:37303368-37303390 GTGGCTGCCCTCCACCAGCAAGG - Intronic
931795978 2:65710581-65710603 CAGCATTCCAGCCACCAGGAAGG - Intergenic
932458222 2:71863510-71863532 CAGGCTTCCCTCCAACTGCGAGG - Intergenic
932737160 2:74262269-74262291 GAGGCTTCGCTACACCAGCAAGG - Intronic
934296526 2:91747220-91747242 CAGGAAACCCTGCCCCAGCAGGG + Intergenic
935211538 2:100943151-100943173 CAGTCTGCCCTGCACCAGCAAGG + Intronic
935350180 2:102145714-102145736 CAGGCTTCCCTCCACATTCACGG - Intronic
939643532 2:144669287-144669309 CAGCCTTGCCTCCCCCAGCATGG - Intergenic
944573809 2:201071774-201071796 AAGGATTCCGTCCCCAAGCAAGG + Exonic
945202698 2:207298939-207298961 CAGGAATCCTACAACCAGCAAGG + Intergenic
945292023 2:208136022-208136044 GAGGAGTCGCACCACCAGCATGG - Intergenic
947822977 2:233084858-233084880 AAGGAACCCCTCCACCAGCACGG - Intronic
948619473 2:239225483-239225505 CTGGACTCCCACCACCTGCAGGG + Intronic
949065338 2:241986938-241986960 CGGGATTCCCTCCTCCAGTAGGG + Intergenic
1170748410 20:19121490-19121512 CAGAATTGCCTCCACCAGGATGG - Intergenic
1171964325 20:31517752-31517774 CAGGATTCTCTTCCCCAGAAAGG - Intronic
1173609394 20:44355709-44355731 CAGGAGCCCGTCCACCAGGAAGG - Intronic
1178917794 21:36718647-36718669 TAGGACTTCCTCCACCACCAAGG - Intronic
1180357649 22:11855997-11856019 CAGGATCACCTCCTCCAGCCAGG - Intergenic
1180380616 22:12136336-12136358 CAGGATCACCTCCGCCAGCCAGG + Intergenic
1181811814 22:25407833-25407855 CTTTATTCCCTCCACTAGCAAGG + Intergenic
1182107854 22:27702034-27702056 CAGGGTGCCCTCCATCGGCAAGG - Intergenic
1182558415 22:31141247-31141269 CAGGAATCTCTCCATCAGGAAGG + Intergenic
1183302192 22:37063856-37063878 CAGGATTTCCTCGAGCAGCGGGG - Intergenic
1183739004 22:39659824-39659846 CTGGAAGCCCTCCACCAGGATGG - Exonic
949412227 3:3778412-3778434 CACCACTCCCTCCACCAGCAGGG - Intronic
949702681 3:6777179-6777201 GAGGGCTCCCTCCACCAGCCAGG + Intronic
950254446 3:11492995-11493017 GCAGATGCCCTCCACCAGCAAGG + Intronic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954806446 3:53223667-53223689 CAGCATCCCCTTTACCAGCAGGG + Intergenic
955056806 3:55462158-55462180 CATCGTTCCCTCCACCAGCTTGG - Intergenic
955337165 3:58096371-58096393 TAGGATTCCCTCTACTAGCTAGG + Intronic
955704548 3:61714693-61714715 CAGGGCTCCTTCCACCAGGAGGG + Intronic
957991385 3:87631649-87631671 CAGAAGTACCTCCACCAGAAAGG + Intergenic
958119260 3:89263348-89263370 GAGGCTGCCCTCCACCAGCAAGG + Intronic
961932542 3:130548778-130548800 CAGGTTTTCCTACCCCAGCATGG + Intergenic
962873823 3:139520258-139520280 CAGGCTTCACCCCAACAGCAGGG - Intronic
967887367 3:194342242-194342264 CTGGAGTCCCTCCACCTGCAGGG - Exonic
968288728 3:197523036-197523058 CAGGATTCCTTCTCCAAGCAGGG + Intronic
969483712 4:7460091-7460113 CAGCAGTCCCTCCCCCTGCATGG + Intronic
969521288 4:7679181-7679203 CAGGGGTCTCTCCCCCAGCAGGG + Intronic
970101260 4:12524839-12524861 CTGCATTGCCTCCACCACCATGG + Intergenic
982109560 4:152041403-152041425 CAGGCATCTCTCCACCAGGAGGG - Intergenic
985043307 4:185914917-185914939 CAGGCTTTCTCCCACCAGCAGGG - Intronic
986724944 5:10588000-10588022 CAGTTTTCCTTCCACCAACAGGG + Intronic
988156842 5:27464073-27464095 CAGCATTCCTTCCTCCAGAAAGG + Intergenic
993194527 5:84723350-84723372 CAGGATTGCTTCCAGCATCACGG - Intergenic
994268847 5:97752921-97752943 CAAGATTGGCTCCACCAGCCTGG - Intergenic
994496336 5:100517843-100517865 CTGGATTCCCTGAACCAGCCTGG + Intergenic
995420657 5:111963042-111963064 GCGGCTGCCCTCCACCAGCAAGG - Intronic
997587431 5:135051778-135051800 CAGGGCTCCCTCCCCAAGCAGGG - Intronic
997840382 5:137234225-137234247 CAGGATTCTCAGGACCAGCAGGG + Intronic
999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG + Intergenic
1001202092 5:169727462-169727484 CAGGCCCCCCTCCACCACCACGG - Intronic
1001888408 5:175317352-175317374 GAGGTTTCCTTCCACCAACATGG + Intergenic
1002173186 5:177386477-177386499 CAGGATCCCCACCACCAGCCCGG - Exonic
1002417943 5:179130500-179130522 CAGGAAGCCCTACTCCAGCAGGG - Intronic
1002926473 6:1608609-1608631 CAGGCCTCCCTCCCCCGGCACGG - Intergenic
1002999715 6:2319650-2319672 GTGGCTGCCCTCCACCAGCAAGG + Intergenic
1003520275 6:6852661-6852683 AAGCAATCCCTCCACCAGCTAGG - Intergenic
1007377831 6:41468617-41468639 CAGGATGTCCCCCACCTGCACGG + Intergenic
1011771408 6:90677600-90677622 CAGGGTGCCCTCCATCACCATGG - Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1014113338 6:117645632-117645654 CAGGAATCCCTACACCACCAGGG + Intergenic
1016810530 6:148257145-148257167 CAGGATTCTATCCAGAAGCATGG + Intergenic
1020262757 7:6539858-6539880 CAAGATTTCATCCACCTGCAAGG + Exonic
1021626239 7:22595724-22595746 CAGGATTGCCTCACCCTGCAGGG - Intronic
1023491376 7:40746238-40746260 CAGGATTCGCCCCACAAACAAGG + Intronic
1024779831 7:52834995-52835017 GAGGATTGCCCTCACCAGCATGG - Intergenic
1025731167 7:64109480-64109502 TAGGATCACCTCCACCAGCTGGG + Intronic
1034266846 7:149785287-149785309 CATCCTTCCCTCCACCAGAAGGG + Intergenic
1034859203 7:154581715-154581737 CAGAAGTCCCTGCACCTGCAGGG - Intronic
1035326666 7:158070464-158070486 CAGGAGCACCTCCACCACCACGG - Intronic
1035326677 7:158070500-158070522 CAGGAGCACCTCCACCACCACGG - Intronic
1035326722 7:158070644-158070666 CAGGAGCACCTCCACCACCATGG - Intronic
1035642440 8:1194318-1194340 CCGGGCTCCCTCCACCAGCCGGG - Intergenic
1037472980 8:19228952-19228974 GTGGCTGCCCTCCACCAGCAAGG + Intergenic
1039609027 8:38904288-38904310 CAGGAGCCCCTGCCCCAGCAGGG - Intronic
1040951265 8:52940656-52940678 CAGGATTGCCACCACCAGGAAGG - Exonic
1041669588 8:60479134-60479156 CAGGCTCACCTCCTCCAGCATGG + Intergenic
1048447136 8:134499878-134499900 CAAGAGGCCCTCCACCAGCTGGG + Intronic
1048856706 8:138692801-138692823 CAGGGCTCTCTCCACAAGCAGGG + Intronic
1050083191 9:1936769-1936791 CAGGCGTCCCTCCCCCAGCCTGG + Intergenic
1050386591 9:5097317-5097339 TAGGATCACCCCCACCAGCAGGG - Intronic
1051164155 9:14243842-14243864 CAGGAAACCCTCCAGCAGCAAGG - Intronic
1053120885 9:35546903-35546925 CAGCAGTCCTTCCACCTGCATGG + Exonic
1054354368 9:64047394-64047416 TAGGATCACCTCCACCAGCCAGG - Intergenic
1056633576 9:88313646-88313668 CAGGCCTCTCTCCACCAGGAAGG + Intergenic
1057023360 9:91718220-91718242 CTGGATTCCCTCCACCTGTCTGG + Intronic
1060045910 9:120340391-120340413 CAGGATTCCTTCTACCTGGAAGG + Intergenic
1060881265 9:127119891-127119913 CAGGTTTCCCTGCTCCAGCCTGG - Intronic
1187849221 X:23574904-23574926 CAGGATTTCCTCCACAAGACAGG + Intergenic
1192727519 X:73768331-73768353 CAGGTGCCCCTCCCCCAGCAAGG - Intergenic
1192986715 X:76407524-76407546 AAAGATTTCCTCCACCAGCTGGG - Intergenic
1194097910 X:89666075-89666097 CCCCATTCCCTCCAGCAGCATGG - Intergenic
1194756485 X:97744664-97744686 AAGGTTTCCCTCCCCCAGGATGG + Intergenic
1195460302 X:105116100-105116122 CCGGCTTCCCTCCACTTGCAGGG - Intronic
1195471569 X:105236028-105236050 CAGGCTCCACTGCACCAGCATGG - Intronic
1200450932 Y:3327464-3327486 CCCCATTCCCTCCAGCAGCATGG - Intergenic
1202343904 Y:23900870-23900892 CAGGACTCCCACCTCCAGCCTGG - Intergenic
1202526864 Y:25769214-25769236 CAGGACTCCCACCTCCAGCCTGG + Intergenic