ID: 1012263408

View in Genome Browser
Species Human (GRCh38)
Location 6:97113401-97113423
Sequence CAGGAAATGTCAATGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012263408_1012263419 18 Left 1012263408 6:97113401-97113423 CCTCCCACCATTGACATTTCCTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1012263419 6:97113442-97113464 CCTCTTATGCATGAAACATAAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1012263408_1012263421 25 Left 1012263408 6:97113401-97113423 CCTCCCACCATTGACATTTCCTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1012263421 6:97113449-97113471 TGCATGAAACATAAGGGAACAGG No data
1012263408_1012263420 19 Left 1012263408 6:97113401-97113423 CCTCCCACCATTGACATTTCCTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1012263420 6:97113443-97113465 CTCTTATGCATGAAACATAAGGG 0: 1
1: 0
2: 1
3: 6
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012263408 Original CRISPR CAGGAAATGTCAATGGTGGG AGG (reversed) Intronic
901824514 1:11852020-11852042 CAGGAAATGTCAGTGGAGAGTGG + Intergenic
903862891 1:26375647-26375669 CAAAATATGTCACTGGTGGGGGG + Intergenic
904007483 1:27371032-27371054 CAGGAACTGTGAGGGGTGGGTGG + Intronic
906881324 1:49594519-49594541 CAGGGACTGTCAGTGGTGGATGG - Intronic
907590091 1:55658255-55658277 CAGGAAATGTGCACAGTGGGAGG - Intergenic
908045845 1:60167562-60167584 AAGGAACTGACAGTGGTGGGAGG - Intergenic
912684359 1:111750220-111750242 CAGGCAATCCCCATGGTGGGGGG + Intronic
913709058 1:121462130-121462152 CATGAAATGTTCATGGTGGTTGG + Intergenic
917046440 1:170865913-170865935 CAGGAAAAGTCAAGTCTGGGAGG - Intergenic
918658920 1:187065035-187065057 CAGGACATCTCAATAGTGTGTGG + Intergenic
919654021 1:200180282-200180304 CGGGAGATGTCCATGGTGGCAGG - Intergenic
920528081 1:206683616-206683638 CAGGAAAGGACAGTGTTGGGAGG + Intronic
922093575 1:222421580-222421602 GATGAGATGTAAATGGTGGGGGG - Intergenic
922364013 1:224846947-224846969 CAGGACATCTCAAAGGTGGTGGG - Intergenic
924532621 1:244906125-244906147 CAGAAAAAGTAAATAGTGGGAGG - Intergenic
1069652235 10:70057891-70057913 CAGGAAAACGAAATGGTGGGGGG + Intronic
1069850620 10:71402067-71402089 CAGGATCTGTCAATGGTGAGTGG + Intronic
1072424787 10:95320796-95320818 TAGGAAGGGTCAATGGTGAGTGG - Intronic
1072931519 10:99667698-99667720 CAGCAAATTGGAATGGTGGGTGG + Intronic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1076736711 10:132462302-132462324 AAGGAAATAACGATGGTGGGGGG + Intergenic
1079331519 11:19536797-19536819 CAGGAAATGATAATGGGGGCTGG + Intronic
1082806988 11:57457973-57457995 CAGCAAATGTGGATGGGGGGAGG + Intergenic
1083376825 11:62230300-62230322 CAGGCATTGTTAATGGTGGAGGG - Intergenic
1083787388 11:64959285-64959307 CAGGTAATTTCAAAGGTAGGAGG - Exonic
1084970787 11:72770977-72770999 CAGCAAATGTGGATGGTGTGTGG + Intronic
1086008893 11:82074197-82074219 CAGGAAACATCAATGATAGGAGG - Intergenic
1086318388 11:85617444-85617466 CAGGCAATTTCAATGCTGTGTGG - Intronic
1087403822 11:97703478-97703500 GAGGAAATATCAAGGGTAGGGGG - Intergenic
1088706719 11:112470633-112470655 CCGAAAATGTCAATAGTGGCAGG - Intergenic
1090211449 11:124923629-124923651 AAAGAAATGTCACTGGGGGGAGG - Intronic
1090705072 11:129328508-129328530 CAGGAAAGGTGAAGGGTGGGAGG + Intergenic
1090946056 11:131430743-131430765 CAGGCAAGGCCCATGGTGGGGGG - Intronic
1095263217 12:40122422-40122444 CAGGGAATGGTATTGGTGGGAGG + Intergenic
1097590375 12:61567284-61567306 CAGGACAACTCAAAGGTGGGGGG - Intergenic
1098615023 12:72511581-72511603 AAGAAAATGTACATGGTGGGAGG + Intronic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1100764374 12:97847176-97847198 CAGGAAATGTGAATGGTTTCTGG + Intergenic
1101506109 12:105348047-105348069 CAGGAACTGTTAAAGATGGGTGG + Intronic
1101753015 12:107598721-107598743 CAGGGAATGTCCATGCTGGGAGG + Intronic
1104288469 12:127446916-127446938 CCGGAAATGTTCATGGTGGTTGG + Intergenic
1105353065 13:19633463-19633485 CGGAAAAGGTCAAGGGTGGGAGG - Intergenic
1106431984 13:29689346-29689368 AAGGCAGTGTCAGTGGTGGGAGG + Intergenic
1106624904 13:31410502-31410524 CAGGAAAGCTTAAGGGTGGGAGG + Intergenic
1108581062 13:51828492-51828514 CAGGAAATGTTGATGGGGGCAGG + Intergenic
1109018787 13:57056963-57056985 GAGCAAATGTCAAGGGTGGACGG - Intergenic
1109599378 13:64604147-64604169 CTGAAAGTGTCAATAGTGGGAGG - Intergenic
1110636825 13:77776160-77776182 CAGGAAATATCATAGGTGGGTGG + Intergenic
1114555662 14:23560993-23561015 CATGAAATGCCAAGGGTGGGAGG + Intronic
1115819540 14:37199010-37199032 CAAGACATGTCATTGATGGGAGG + Intronic
1116318806 14:43433290-43433312 CAGAATATGTCCATGGTGGTTGG + Intergenic
1116832849 14:49739388-49739410 CAGGAAATTTCCATGGTTAGAGG + Intronic
1116991168 14:51278231-51278253 CAGGAAATGGCGGTGGTGGTGGG + Intergenic
1117539979 14:56737658-56737680 GGGGAAAAGTCAAAGGTGGGGGG - Intergenic
1117586664 14:57214147-57214169 CTGGACATGCCAATGGTAGGTGG - Intronic
1118958810 14:70508464-70508486 CAGGGACTGTCAGGGGTGGGAGG + Intergenic
1119711176 14:76823346-76823368 AAGGAAATGTCACAGGTTGGAGG + Intronic
1121252700 14:92511691-92511713 GAGGAAAAGTCAGTGGGGGGTGG + Intergenic
1121451069 14:94008728-94008750 CAGGAAATGTCCAAGGAGGCGGG + Intergenic
1121722692 14:96121805-96121827 CAGGAATTGACTATGGAGGGAGG + Intergenic
1123015215 14:105370319-105370341 CATGGAATGTCAGTAGTGGGGGG - Intronic
1125973467 15:43930861-43930883 AAGGAAATGTCATGGGAGGGAGG + Intronic
1126946511 15:53827680-53827702 CAGAAAATGTCAATTCTGGCTGG + Intergenic
1127245556 15:57169379-57169401 CAGTAAATGTCAGTTGAGGGGGG + Intronic
1130120406 15:81042737-81042759 CAGGAAATGAGAGTGGTGAGTGG - Intronic
1133131229 16:3677132-3677154 CAGGAAATGCCAGGGCTGGGAGG + Intronic
1134614308 16:15638287-15638309 CAGGAAATGTCAAAATTGGCTGG + Intronic
1137056479 16:35748738-35748760 CTGGAAAGGGCAAAGGTGGGCGG - Intergenic
1139072312 16:63397876-63397898 CAGTAAATATTAATGATGGGAGG - Intergenic
1142241050 16:88945792-88945814 CAAGAAACGTGAATGCTGGGTGG - Intronic
1143234410 17:5386537-5386559 TAAGAAATGACTATGGTGGGAGG - Intronic
1144830841 17:18130466-18130488 CAGGAGATGCCAATGGTCAGAGG + Intronic
1148190072 17:45672197-45672219 CCTGGAATGGCAATGGTGGGAGG + Intergenic
1148588960 17:48801197-48801219 GAGGAAATGTAAATGGGGAGGGG + Intronic
1148699313 17:49578381-49578403 GAGGAAAGGACAATGGGGGGGGG + Intronic
1150809395 17:68344784-68344806 CAGGAAATTGCAAGGGAGGGAGG + Intronic
1151122163 17:71805124-71805146 CAAGGAAGGTCAGTGGTGGGAGG - Intergenic
1152159010 17:78655695-78655717 CAGGAGAGGCAAATGGTGGGCGG + Intergenic
1152576788 17:81144596-81144618 CTGGAAATGTGAATGGCCGGGGG - Intronic
1153168783 18:2292221-2292243 CAAGGTATGTTAATGGTGGGGGG - Intergenic
1155305398 18:24473257-24473279 CAGGAAATCTCATGGCTGGGAGG + Intronic
1158695538 18:59700104-59700126 GAGGAAATCCCAACGGTGGGTGG + Intergenic
1159786604 18:72722232-72722254 GAGGAAAAGTCAGTGGAGGGGGG - Intergenic
1160069465 18:75612685-75612707 CCAGAAATGTGAATTGTGGGAGG + Intergenic
1162332268 19:10037657-10037679 CAGGGCATTTCCATGGTGGGTGG - Intergenic
1165381088 19:35480859-35480881 CAGGAAATGCCAAGGTTGGGGGG + Intergenic
1165775251 19:38400554-38400576 CAGGAAATTTCAAACATGGGAGG + Intergenic
1165903625 19:39180144-39180166 CAGGACCTGTGAAGGGTGGGAGG - Intronic
1167537933 19:50067190-50067212 AAGGAAATGTTCAGGGTGGGTGG - Intergenic
926699021 2:15790396-15790418 CAGGAAATGTTAAAGATGAGAGG - Intergenic
929285496 2:40130812-40130834 CTTGAAATGTCAATGTTGAGAGG + Intronic
929453405 2:42050765-42050787 CAGGAAAAGTGAAAAGTGGGGGG + Intronic
929902258 2:46015404-46015426 CAGGAAATGCCAAAGGGTGGGGG - Intronic
932413200 2:71559266-71559288 CAGGAAAAGACAGTGCTGGGAGG - Intronic
932480026 2:72033484-72033506 CAGGGAATGCTGATGGTGGGCGG - Intergenic
934636923 2:95998172-95998194 CAGGACCTGTCAATGGGGTGAGG - Intergenic
934796728 2:97107249-97107271 CAGGACCTGTCAATGGGGTGAGG + Intergenic
935052779 2:99537535-99537557 CAAGAAAATTCAATGGGGGGTGG + Intergenic
936470761 2:112796837-112796859 CAGGGAATGTCAAATGTGGCTGG + Intergenic
940975171 2:159934954-159934976 GAGGAAATGTCAAGGATTGGAGG - Intronic
943371586 2:187023119-187023141 CAGGCAAAGGCTATGGTGGGTGG - Intergenic
943554368 2:189383905-189383927 TAGGAAAGGTGAATGGGGGGAGG - Intergenic
944821435 2:203436175-203436197 CAGGATATGCCTTTGGTGGGTGG + Exonic
947618018 2:231570693-231570715 CAGGAAACCTCAAAGCTGGGGGG + Intergenic
947757708 2:232579995-232580017 CAGGAAAAGTCACTAGTGGCTGG + Intronic
947793008 2:232878386-232878408 CCCGAAGTGTCCATGGTGGGGGG - Intronic
948445567 2:238030228-238030250 CAGAAAATGACAATGGTGGCTGG - Intronic
1169689280 20:8312209-8312231 GAGGGGATGTCATTGGTGGGTGG - Intronic
1170704073 20:18728889-18728911 CAGGAATTGTCACTCCTGGGAGG - Intronic
1172180355 20:32999730-32999752 CAGTATATGTCAGTGGAGGGAGG + Intronic
1172934420 20:38609562-38609584 CAGGCAATGACCATGGAGGGCGG + Intronic
1173258366 20:41411269-41411291 GAGGAAATGACTAGGGTGGGCGG + Intronic
1174115597 20:48224510-48224532 AAGGGAAGGTCAAAGGTGGGCGG + Intergenic
1175330207 20:58158353-58158375 CAAGAAATGGTAATGGTGGCCGG + Intronic
1178937018 21:36872012-36872034 AAGAAAATGTTAATGGTAGGTGG - Intronic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179602673 21:42490687-42490709 CAGGAAATGTCAAGGGTTTTAGG - Intronic
1179673262 21:42964408-42964430 CAGGAAGGGCCAATGGTGAGCGG + Intergenic
1180135129 21:45857568-45857590 CAGGACAGCTCAAAGGTGGGGGG - Intronic
1182282637 22:29226175-29226197 CAAGAAATGGCAATGGGGCGGGG - Intronic
1182484992 22:30634242-30634264 CAGGAAATGGCAAGGGGGTGCGG + Intergenic
1185257788 22:49845658-49845680 CAGGAAATTTCAATGGTTTTAGG + Intergenic
949194659 3:1290327-1290349 CAGGAAATGTTAATGGGGGAGGG + Intronic
949318298 3:2781673-2781695 CAGGACAGCTCAAAGGTGGGGGG + Intronic
949502559 3:4695525-4695547 CAGGAAAGGGGAATGGGGGGAGG - Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
952107273 3:30085010-30085032 CATGAACTGCCCATGGTGGGAGG + Intergenic
952821696 3:37491585-37491607 CTGGACTTGTCAATGGAGGGAGG + Intronic
954443584 3:50534779-50534801 CAGGAAGCGTAAATGGTGGCGGG - Intergenic
954931192 3:54283350-54283372 CAGGAGATATCCATGGAGGGAGG - Intronic
956294985 3:67702821-67702843 CAGTAATTGTCAACGTTGGGTGG - Intergenic
959420508 3:106122290-106122312 CAGGAAATGTCAATGGGTGCTGG - Intergenic
959781792 3:110242638-110242660 CAGGAAATGTCAAAGGTTTTAGG + Intergenic
963575732 3:147059160-147059182 CAAAATATGTTAATGGTGGGGGG - Intergenic
964384997 3:156137890-156137912 CAGTAAAGGTAAAGGGTGGGAGG - Intronic
966244684 3:177794073-177794095 CAGGAAAAGTCCATTCTGGGTGG + Intergenic
972693991 4:41426643-41426665 TAGGAAATGACAATGCTGTGTGG - Intronic
972979949 4:44685174-44685196 CAGTAGTTGTCAGTGGTGGGTGG + Intronic
973195930 4:47441473-47441495 CAGGAGATGTCAATCTTGGCTGG + Intergenic
975174098 4:71267549-71267571 GAGGAAATGGCCAAGGTGGGTGG + Intronic
975617713 4:76264229-76264251 CAAGAAATGTCAAGGCTGGAGGG + Intronic
975939652 4:79627454-79627476 CATAGAATGTCAGTGGTGGGAGG - Intergenic
977033307 4:91916119-91916141 CAGAAAATGTCAAGGATGTGAGG + Intergenic
978222227 4:106290668-106290690 CAGGACTAGTCCATGGTGGGGGG - Intronic
981180921 4:141743074-141743096 CAGGAAATGTACATGTTGGTTGG - Intergenic
984321587 4:178204093-178204115 TAGGAAGTGGCAATGTTGGGAGG + Intergenic
984398254 4:179227861-179227883 CAGGAAATGTAAATAGAGAGTGG - Intergenic
984539465 4:181019707-181019729 AAGAAAATGTGAATGGTGTGAGG + Intergenic
985023182 4:185712973-185712995 CAGGTGATGTCAATGGAGGAAGG - Intronic
985312789 4:188620007-188620029 CAGGAAATGTCTGCGGGGGGTGG + Intergenic
986109197 5:4694146-4694168 GAGGAAATCTAAATTGTGGGTGG + Intergenic
986884761 5:12219805-12219827 CAGGGAAGGGTAATGGTGGGGGG - Intergenic
988042371 5:25905860-25905882 CAGGAAATGTCAAAGATTGCTGG - Intergenic
989968451 5:50492569-50492591 CATGAAATGTTTATGGTGGTTGG - Intergenic
991335743 5:65545119-65545141 CAGGAAAGGAGAAAGGTGGGGGG + Intronic
992296330 5:75330594-75330616 AAGGAAATGAAAATGGAGGGAGG - Intergenic
994232532 5:97324488-97324510 CAGGAAATGACATTGGCTGGAGG - Intergenic
997214287 5:132097435-132097457 CAGCAAATCTCAGTGGTGTGGGG + Intergenic
997716639 5:136047651-136047673 CTGGAAAGGTCAGTGGTGTGTGG + Intronic
1003183941 6:3814199-3814221 CTGGTAATGGCAGTGGTGGGTGG - Intergenic
1005473271 6:26182870-26182892 CGGGAAATGGGAATGGTGGCAGG + Intergenic
1009498329 6:64378543-64378565 AATGAAATATCAATGCTGGGGGG + Intronic
1009767441 6:68099114-68099136 CAGCAAATGTCAAGGTTGTGAGG + Intergenic
1009861544 6:69340767-69340789 CAGGTCCTGTCAAGGGTGGGGGG - Intronic
1011841403 6:91504532-91504554 CAGGATATGTGTATGGTCGGTGG + Intergenic
1012263408 6:97113401-97113423 CAGGAAATGTCAATGGTGGGAGG - Intronic
1012935909 6:105366915-105366937 CAGGTGATGGCAGTGGTGGGTGG + Intronic
1013707629 6:112857287-112857309 CAGGAAAGCTCAAGGATGGGAGG - Intergenic
1015361590 6:132345890-132345912 CAGGAGATGTAACTGGTTGGAGG - Intronic
1019305626 7:333035-333057 CAGGGACTGTCAATCCTGGGCGG - Intergenic
1021273939 7:18626111-18626133 CAGAAAATAGCAATAGTGGGAGG + Intronic
1021621720 7:22555864-22555886 AAGGGAATCTCCATGGTGGGAGG - Intronic
1022972699 7:35532035-35532057 CAGGAAATGCCAAGTGTGGATGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024159174 7:46656854-46656876 CTTGAAGTGTCAATAGTGGGTGG - Intergenic
1029841821 7:103372554-103372576 CATGGAATGTCAAAGGTTGGAGG - Intronic
1030564663 7:111138387-111138409 CAGGAAATGCCAGTGCTGGAGGG - Intronic
1030801025 7:113852134-113852156 TAGGAAATGTCAGGGGTTGGGGG - Intergenic
1031107444 7:117562525-117562547 CAGGAAATGGCAATGGGGTTGGG + Intronic
1031564355 7:123276935-123276957 AGGGAAATGTCAGTGGGGGGTGG - Intergenic
1032474691 7:132203871-132203893 CAGGAAATGTCCAGGGTAGGTGG + Intronic
1032606432 7:133359567-133359589 CAGGATATTTCACTGGAGGGTGG - Intronic
1032868502 7:135954502-135954524 AAGGAAATGTTAATAATGGGGGG - Intronic
1033056744 7:138062084-138062106 CAGGAAAAGTCTATGGAGAGAGG + Intronic
1035726512 8:1827642-1827664 CAGGAAATGGCAATGATGGAAGG - Intronic
1039259239 8:35752607-35752629 TATTAAATGACAATGGTGGGAGG - Intronic
1039470929 8:37813579-37813601 CAGGAAATGTCACCACTGGGGGG + Intronic
1043395548 8:79832199-79832221 CAGGAAAGGCCAGGGGTGGGGGG + Intergenic
1044438780 8:92198256-92198278 AAAGAAATGACAGTGGTGGGGGG + Intergenic
1045616271 8:103916207-103916229 CAGGAAAGGACAATGATCGGAGG - Intronic
1047673365 8:127172734-127172756 GAGGAAAAGTAAATGGAGGGTGG + Intergenic
1048064737 8:130956396-130956418 CAGGAAATGACAATGGAGAAAGG - Intronic
1049275214 8:141716919-141716941 CAGGACAGGCCACTGGTGGGAGG + Intergenic
1049420646 8:142515074-142515096 CAGGAGAAGCCATTGGTGGGAGG + Intronic
1049845768 8:144800212-144800234 CAGAAAATGTCAAGGGGAGGAGG - Intronic
1050022711 9:1301685-1301707 CAGGAAATGTGACAGGTGTGGGG + Intergenic
1055922461 9:81475354-81475376 AAGGAAGTCTGAATGGTGGGAGG + Intergenic
1056586453 9:87930555-87930577 CGGGAAATGTTAAAGGTGGTGGG - Intergenic
1056610426 9:88122387-88122409 CGGGAAATGTTAAAGGTGGTGGG + Intergenic
1057106241 9:92420284-92420306 AAGGAACTGACAATGTTGGGAGG - Intronic
1057830182 9:98400372-98400394 CAGGAAATCCCAAATGTGGGTGG + Intronic
1060458554 9:123825488-123825510 CCTGAAATGTCAATGGTTGCAGG + Intronic
1185979330 X:4758903-4758925 GAGGAAATATCAATGGTTTGGGG + Intergenic
1187000185 X:15168569-15168591 CAGGAAATGAAAGTGGTTGGGGG - Intergenic
1188663641 X:32791223-32791245 CGGGTAATGGCAATAGTGGGAGG - Intronic
1188778080 X:34246888-34246910 CAAGAAATGTCAATGGTAGTGGG + Intergenic
1189701954 X:43721050-43721072 CAGGAAGAGTCAATGGTATGTGG + Intronic
1191201291 X:57784931-57784953 CAGGGACTGTCATTGGGGGGGGG + Intergenic
1196818255 X:119682452-119682474 CAGGAAATGTAATTGGGGAGGGG - Intronic
1196848931 X:119919068-119919090 CAGGAAATGAGACTGGTGGAGGG + Intronic
1197900123 X:131362375-131362397 AACGAAAAGTCAGTGGTGGGAGG - Intronic
1199024931 X:142925417-142925439 CAGCAGATGTCAATGGTTGGAGG + Intergenic
1199565576 X:149212274-149212296 CAAGAAATGCCAGAGGTGGGAGG + Intergenic