ID: 1012272181

View in Genome Browser
Species Human (GRCh38)
Location 6:97226964-97226986
Sequence CTAGTTCAGTAGTTCTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 4, 2: 28, 3: 191, 4: 588}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012272181_1012272182 0 Left 1012272181 6:97226964-97226986 CCAGTTGAGAACTACTGAACTAG 0: 1
1: 4
2: 28
3: 191
4: 588
Right 1012272182 6:97226987-97227009 AGAATGAAGAAGTGAAGCTGAGG 0: 1
1: 0
2: 2
3: 53
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012272181 Original CRISPR CTAGTTCAGTAGTTCTCAAC TGG (reversed) Intronic
901484300 1:9547763-9547785 CTAAACCAGTAGTTCTCAATTGG - Intronic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
903105399 1:21074348-21074370 CTAAGTCAGTTGTTCTCAACTGG - Intronic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
905798420 1:40828469-40828491 GTAGAGCAGTGGTTCTCAACTGG - Intronic
906065475 1:42977475-42977497 CTAAGTCAGTAGGTCTCAAGTGG + Intergenic
907363690 1:53943388-53943410 GTACTCCAGTGGTTCTCAACTGG + Intronic
907810893 1:57868635-57868657 CTACTGCAGTGGTTCTCAACTGG - Intronic
908077885 1:60540999-60541021 CTAATTCAGTAGTTCTGGAGTGG + Intergenic
908185005 1:61644055-61644077 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
908537748 1:65093733-65093755 CTAGTTCACACATTCTCAACAGG - Intergenic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
908857111 1:68443227-68443249 CTAGGCAACTAGTTCTCAACTGG + Intronic
909272526 1:73642342-73642364 CTGGATCAGAAGTTTTCAACAGG + Intergenic
909319264 1:74262374-74262396 CTAAATCAGTTGTTCTCAACTGG - Intronic
909772454 1:79440982-79441004 TTAGTCCAGTGATTCTCAACTGG + Intergenic
909892846 1:81029443-81029465 CAAACTCAGTGGTTCTCAACTGG + Intergenic
910299439 1:85689694-85689716 GTACTTAAGCAGTTCTCAACTGG + Intronic
911075848 1:93874171-93874193 CAAGGACAGTGGTTCTCAACTGG + Intronic
911506840 1:98763613-98763635 CTAATTCTGTGGTTCTCAGCTGG + Intergenic
911577038 1:99590301-99590323 TTAGAGCAGTAGTTCTCAGCTGG + Intergenic
911627209 1:100137803-100137825 CTGGCCCAGTGGTTCTCAACTGG - Intronic
913280319 1:117179294-117179316 CTAAATCAGTGGTTCTCAGCTGG - Intronic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
914809250 1:151014731-151014753 GTAACCCAGTAGTTCTCAACTGG + Intronic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
915621741 1:157090411-157090433 CTACTTAAGTGGTTCTCCACTGG + Intergenic
915947287 1:160162736-160162758 CTAACACAGTGGTTCTCAACTGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916583609 1:166130449-166130471 TTAATGCAGTGGTTCTCAACTGG + Intronic
918235329 1:182574729-182574751 TTAAGGCAGTAGTTCTCAACTGG - Exonic
918333137 1:183479445-183479467 CTAAATCAGTGGTTCTCAACTGG - Intronic
918643921 1:186880432-186880454 TTAGTGCAGTGGTTCTAAACTGG + Intronic
918722130 1:187866438-187866460 ATAGTCCAGTGATTCTCAACTGG - Intergenic
918970563 1:191411039-191411061 CTTGTTGACTAGCTCTCAACTGG - Intergenic
919317113 1:195985626-195985648 CTAGTTTATTAGTTCTAAAAGGG + Intergenic
919525962 1:198650651-198650673 CCCATTCAGTAGGTCTCAACTGG + Intronic
919677213 1:200395315-200395337 CTAAATCAGTGGTTCTCAGCTGG - Intergenic
919707784 1:200695240-200695262 TTAACTTAGTAGTTCTCAACTGG + Intergenic
920333159 1:205226903-205226925 CTAGGCCAGTGGTTCTCAAAGGG + Intergenic
920881652 1:209886418-209886440 CTGTATCAGTGGTTCTCAACTGG - Intergenic
922177898 1:223211275-223211297 CTAGCACAGCAGTTCTCAACTGG - Intergenic
922234207 1:223711206-223711228 CTACAGCAGTGGTTCTCAACTGG - Intronic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
924234158 1:241986788-241986810 CTAGACCAGTGGTTCTCAGCCGG + Intergenic
1064014365 10:11761199-11761221 CTAGATCCGTGGTTCTAAACTGG + Intronic
1064460741 10:15532490-15532512 CTAGGTCAGTGGTTCTTAACTGG - Intronic
1064665497 10:17646383-17646405 CTAGTGCAGCGGTTCTCAACTGG - Intronic
1065181658 10:23132186-23132208 TTAGCTCAGGAGTTCTCACCTGG + Intergenic
1065706826 10:28478279-28478301 CTAAAACAGTGGTTCTCAACTGG + Intergenic
1066151358 10:32622770-32622792 TTAACACAGTAGTTCTCAACTGG - Intronic
1066318444 10:34273909-34273931 CTAGCTCAGTGTTTCTCAACAGG + Intronic
1066377334 10:34869192-34869214 CTAAAACAGTAGTTCTCAACTGG - Intergenic
1067958942 10:50825846-50825868 TTAGGCCAGTGGTTCTCAACTGG + Intronic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1068690605 10:59909951-59909973 CTAGTTCAGTGGTTCCAAACTGG - Intergenic
1068764593 10:60749010-60749032 CTAGCACAATGGTTCTCAACTGG + Intergenic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1069396838 10:67998695-67998717 CTATGCCAGTAGTTCTCAAAAGG + Intronic
1070158334 10:73850382-73850404 CTAGAGCAGTGGTTTTCAACTGG + Intronic
1070371879 10:75790311-75790333 CTAGATCAGTAGTTCTCAACTGG - Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1071762332 10:88622512-88622534 CTAATTCAGTAGATCTCAGGTGG + Intergenic
1072156505 10:92728735-92728757 CCAGGACAGTGGTTCTCAACTGG - Intergenic
1072167813 10:92830731-92830753 CTAGGCTAGTGGTTCTCAACTGG - Intergenic
1072178425 10:92953442-92953464 CTAAGGCAGTAGTTCTCAACTGG + Intronic
1072256444 10:93625880-93625902 GTAGACCAGTGGTTCTCAACTGG + Intronic
1072342145 10:94462495-94462517 TTAGATCAGTAATTCTCAACTGG - Intronic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1073239589 10:102047813-102047835 CCAGATCAGTGATTCTCAACTGG + Intronic
1073415131 10:103374774-103374796 TTATTGCAGTGGTTCTCAACTGG + Intronic
1073569774 10:104569359-104569381 ATAGTTAAGCAGTGCTCAACAGG - Intergenic
1073595697 10:104797918-104797940 CTAATTCAGTAGCTCTGAGCTGG - Intronic
1073605430 10:104890886-104890908 CTAAATCAGTAGTTCTCAACTGG - Intronic
1073912793 10:108366527-108366549 CCAGATCAATAGATCTCAACTGG + Intergenic
1074851087 10:117440193-117440215 CTAGAGAAGTGGTTCTCAACTGG - Intergenic
1075215488 10:120529096-120529118 CTAGGGCAGTGGTTCTCCACTGG + Intronic
1075418758 10:122285500-122285522 ATAGCCCAGTAGTTCTCAACAGG + Intronic
1076076878 10:127540390-127540412 CTAGAATAGTGGTTCTCAACTGG + Intergenic
1076310760 10:129506038-129506060 CTAGGCCAGTGGTTTTCAACTGG + Intronic
1076529689 10:131136115-131136137 CTAGACCAGTGGCTCTCAACTGG - Intronic
1077294383 11:1818463-1818485 CTAGGGCAGTGGTCCTCAACTGG + Intergenic
1078265534 11:9753718-9753740 CTATCACAGTGGTTCTCAACTGG + Intergenic
1078287691 11:9974444-9974466 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1078447423 11:11414928-11414950 CCAGCACTGTAGTTCTCAACTGG + Intronic
1078513133 11:12000841-12000863 ACAGTGCAGTAGTTCTCAACTGG - Intronic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1078923494 11:15853255-15853277 CTGATTCAGTAGGTCTCAAGTGG + Intergenic
1079363372 11:19788317-19788339 TTACTACAGTGGTTCTCAACTGG - Intronic
1079372841 11:19866379-19866401 TTTGATCAGTAGTTCTCCACTGG - Intronic
1079423177 11:20313987-20314009 CCAGGGCAGTAGTTCTCAAAGGG + Intergenic
1080635142 11:34117280-34117302 CTAAATCAGTGGTTCTCATCTGG + Intronic
1081089116 11:38840328-38840350 CTAGCTCAGTTATTTTCAACTGG - Intergenic
1081365357 11:42228497-42228519 CTAGAGCAGCAGTTCTCCACTGG - Intergenic
1081688309 11:45057977-45057999 CTAGAGCAGTGGTTCCCAACTGG - Intergenic
1083550451 11:63585375-63585397 CTAAGTCACTAGTTCTCAACTGG + Intronic
1084336912 11:68463785-68463807 CTAGTTCAAGAGTTCTCAGTTGG + Intronic
1086064165 11:82729489-82729511 CTAGCATAGTGGTTCTCAACTGG + Intergenic
1086496755 11:87411955-87411977 TTAGGGCAGTAGTTCTCAACTGG - Intergenic
1086507029 11:87515837-87515859 TTAATTCAGTAGTTCTCACTAGG - Intergenic
1086941593 11:92803806-92803828 CTGGGGCAGTGGTTCTCAACTGG - Intronic
1087009643 11:93501137-93501159 CTAGATCAGTGGTACTCAACAGG + Intronic
1087132244 11:94678358-94678380 CTCTATCAGTAGTTCTTAACAGG - Intergenic
1087802316 11:102517662-102517684 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1088088479 11:106009225-106009247 CTAGCCCAGAAGTTCTCATCTGG - Exonic
1088235830 11:107721630-107721652 CTAATACAGTATTCCTCAACAGG - Intergenic
1088381465 11:109198131-109198153 GTAGTTCGGTAGCACTCAACTGG + Intergenic
1089709789 11:120306617-120306639 CTAGGCCGGCAGTTCTCAACCGG - Intronic
1090886986 11:130886078-130886100 CTAAGGCAGTAATTCTCAACTGG - Intronic
1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG + Intronic
1091181586 11:133609365-133609387 TTAGTTTAGTAGTTCTCACTTGG + Intergenic
1092468761 12:8759728-8759750 CTAAAGCAGTGGTTCTCAACTGG - Intronic
1093054920 12:14546528-14546550 ATAAGGCAGTAGTTCTCAACTGG + Intronic
1093146465 12:15572778-15572800 CTAGATCAATGGTTCTCAACTGG + Intronic
1093519553 12:20032549-20032571 AAAGTTCAGTAGTTTTCAAGGGG + Intergenic
1093987615 12:25554540-25554562 CTAATTTAGTGGTTTTCAACAGG + Intronic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1094670849 12:32567364-32567386 CTAGGTGAGTAGTTCTCAAGCGG + Intronic
1095426365 12:42078455-42078477 CTAGGTCAGTGGTTCTCACCTGG - Intergenic
1095660451 12:44727137-44727159 ATAGATCAGTAATTATCAACTGG + Intronic
1095770589 12:45951971-45951993 CTATACTAGTAGTTCTCAACCGG - Intronic
1095860058 12:46906798-46906820 CTAGTCTAGTAGCTCTCAATTGG - Intergenic
1096369725 12:51058877-51058899 TTAGACCAGTACTTCTCAACGGG - Intronic
1096890544 12:54766451-54766473 CTAGACCAATGGTTCTCAACTGG + Intergenic
1098049723 12:66440861-66440883 TTTATTCAGTAGTTCTCAACTGG - Intronic
1098385220 12:69911169-69911191 CGAGTTCAGCAGATCTTAACTGG + Intronic
1098571398 12:71991706-71991728 CAAGTCCAGTAGTTCTAAGCCGG - Intronic
1099029331 12:77505812-77505834 CTAGTGCAGTGGTTTTCAATTGG + Intergenic
1099297720 12:80850501-80850523 CAAGGGCTGTAGTTCTCAACTGG + Intronic
1099673483 12:85726273-85726295 ATAGATTAGTAGTTCTCAAGTGG - Intergenic
1100277295 12:93082714-93082736 ATAGTTCTGTGGTTCTCCACTGG - Intergenic
1100296116 12:93263251-93263273 CTAGGGCAGTGGTTTTCAACTGG + Intergenic
1100477532 12:94948411-94948433 CTAGCTCAGTGGCTCTCAGCTGG - Intronic
1101040122 12:100747139-100747161 GTAAGTCAGTGGTTCTCAACTGG - Intronic
1101057738 12:100936453-100936475 CTATGTCCGTGGTTCTCAACTGG - Intronic
1101092762 12:101304583-101304605 CTAATACAGTGCTTCTCAACTGG + Intronic
1101347316 12:103898317-103898339 TTAGAGCAGTAGTTCTTAACAGG + Intergenic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1101930478 12:109009715-109009737 CTAGAGCAGTGGTTTTCAACCGG + Intronic
1101953263 12:109192596-109192618 CTCTTGCAGCAGTTCTCAACTGG - Intronic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102706720 12:114887521-114887543 TTAGACCAGTGGTTCTCAACTGG + Intergenic
1102819128 12:115893237-115893259 CTAATCCAGTGGCTCTCAACCGG + Intergenic
1102841626 12:116131146-116131168 CTTCTTCAGTGGTTCTCAACAGG - Intronic
1102897437 12:116609931-116609953 TTAGAGCAGTGGTTCTCAACAGG - Intergenic
1102910919 12:116713213-116713235 CTAGGGCAGTGGTGCTCAACAGG - Exonic
1103000840 12:117384357-117384379 CTACCCCAGTAATTCTCAACAGG + Intronic
1103033467 12:117637238-117637260 TTGTTCCAGTAGTTCTCAACTGG + Intronic
1103143940 12:118577592-118577614 TTAGACCAGTATTTCTCAACTGG + Intergenic
1103308049 12:119981884-119981906 CTAAACCAGTAGTTCTCAACTGG - Intergenic
1104336049 12:127896544-127896566 CTAGTTAAGTGTTTCTCAGCTGG + Intergenic
1105467414 13:20658804-20658826 TTACTTCAAGAGTTCTCAACTGG - Intronic
1106017290 13:25881825-25881847 CTAGTCCAGTAGTTCTGGGCTGG - Intronic
1106808627 13:33336792-33336814 ATATTTGAGTAGTTCTGAACAGG - Intronic
1107540555 13:41385307-41385329 TTAGTTCATTATTTCTCCACTGG + Intergenic
1107650562 13:42540799-42540821 CTAGACCAGTGGTTCCCAACTGG - Intergenic
1108214200 13:48167949-48167971 CTGGTACAGTTGTTTTCAACGGG - Intergenic
1108273882 13:48788919-48788941 CTGATCCAGCAGTTCTCAACTGG + Intergenic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1109646862 13:65270287-65270309 CTAGGTCAGTACTTGTCCACTGG - Intergenic
1109817814 13:67609588-67609610 TAATATCAGTAGTTCTCAACTGG - Intergenic
1110237765 13:73234308-73234330 TTAGGCCAGTAGTTCTCAACAGG + Intergenic
1110258389 13:73457574-73457596 CTAGTCCAGTAATTTTCAAAAGG - Intergenic
1110415806 13:75250946-75250968 CTAGTCCAGCGGTTCTAAACTGG - Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1111485382 13:88891681-88891703 ATAGATCAGTATTTCTTAACAGG - Intergenic
1112273352 13:97991985-97992007 CTAACTCAGTGGTTCTCAAGAGG - Intronic
1112514349 13:100039135-100039157 CTAGATTAGTGCTTCTCAACTGG + Intergenic
1112718506 13:102214682-102214704 CTAGATCAGGGGATCTCAACCGG + Intronic
1112721892 13:102254810-102254832 CTATGTCAGTGGTTCCCAACTGG - Intronic
1112757374 13:102652736-102652758 AAAGATCAGTATTTCTCAACTGG + Intronic
1112827725 13:103411352-103411374 CTAGAACAATGGTTCTCAACTGG - Intergenic
1113031867 13:106001968-106001990 CTAGAAAAGTGGTTCTCAACTGG - Intergenic
1114141625 14:19918010-19918032 GTAGCACAGTGGTTCTCAACTGG + Intergenic
1114664847 14:24371504-24371526 CTAGGACAGTGGATCTCAACTGG - Intronic
1114999328 14:28402086-28402108 TTATATCAGTAGTTCTCAGCTGG + Intergenic
1115030598 14:28788696-28788718 CAATTGCAGTGGTTCTCAACTGG + Intronic
1115177519 14:30580913-30580935 TAAGATCAGTAGTTCTCAACTGG - Intronic
1115238672 14:31233246-31233268 CTGATTCAGTAGATCTCAAGTGG - Intergenic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1116572759 14:46538641-46538663 TTACTCCAGTGGTTCTCAACAGG - Intergenic
1116823715 14:49650811-49650833 CTATTTCCGTACTTCTCAAATGG + Intronic
1117829967 14:59740508-59740530 CTAGCATAGTAGTTTTCAACTGG - Intronic
1117854915 14:60019188-60019210 CTGGTACAGTAGTTGTCTACTGG - Exonic
1118108824 14:62693276-62693298 GTAGATCAGTAGTTCTCAACTGG - Intergenic
1118449303 14:65884371-65884393 CTAGATCATTAATTCTCAACTGG - Intergenic
1119008305 14:70955966-70955988 CTAAATCATTATTTCTCAACTGG + Intronic
1119157947 14:72428825-72428847 CTAAGTCAGTGGTTGTCAACTGG + Intronic
1119268713 14:73281977-73281999 TTAGTGTAGTGGTTCTCAACTGG - Intronic
1119555984 14:75552985-75553007 CTAGCTCAGTGGTTCCTAACTGG + Intergenic
1119955089 14:78789319-78789341 CTAGTTAAGGGGTTCTCAACTGG + Intronic
1120386483 14:83853046-83853068 CTATAACTGTAGTTCTCAACTGG + Intergenic
1120701907 14:87707296-87707318 CTAAATCAGTAGTACTCAAATGG + Intergenic
1120909574 14:89653810-89653832 CTAGGGCAGTGGTTCTCAAATGG - Intergenic
1121291634 14:92780384-92780406 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1121787484 14:96673380-96673402 CTGGAGCTGTAGTTCTCAACTGG + Intergenic
1122008697 14:98728008-98728030 CTAGGGCAGAAGTTCTCAACTGG + Intergenic
1122187133 14:100008082-100008104 CTACACCAGCAGTTCTCAACTGG - Intronic
1122332337 14:100930713-100930735 GTACCTCAGTGGTTCTCAACTGG - Intergenic
1124366526 15:29075550-29075572 TTAGAACAGTGGTTCTCAACTGG - Intronic
1124576395 15:30912678-30912700 CTAGCCAAGTGGTTCTCAACTGG + Intronic
1125682517 15:41541049-41541071 CTGGTTCAGTGGTTTTCAACTGG - Intronic
1125895034 15:43294696-43294718 TTATCTCAGTGGTTCTCAACGGG + Intronic
1127158699 15:56156933-56156955 CTGATTCAGTAGGTCTCAAGTGG + Intronic
1127527699 15:59810156-59810178 TTAATGCATTAGTTCTCAACTGG + Intergenic
1128394889 15:67214568-67214590 CTATGTCAGTGGTTCTCAATTGG - Intronic
1128766944 15:70256999-70257021 CTAGACCAGCGGTTCTCAACTGG - Intergenic
1129033207 15:72633069-72633091 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129216677 15:74104161-74104183 TTAGGTCAGCAGTTCTCAACTGG + Intronic
1129407997 15:75331924-75331946 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129471161 15:75754703-75754725 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129733843 15:77948474-77948496 TTAGGTCAGCAGTTCTCAACTGG + Intergenic
1129799567 15:78403815-78403837 ATAATGCAGTGGTTCTCAACTGG + Intergenic
1129841741 15:78747529-78747551 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129854908 15:78816621-78816643 CTAGAACAGTGGTTCTCAAGCGG + Intronic
1129945794 15:79538529-79538551 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
1130016849 15:80194040-80194062 CTAGAACAGTAATTCTCAAAAGG + Intergenic
1130204311 15:81861823-81861845 CTATTTTGGTGGTTCTCAACTGG - Intergenic
1130350478 15:83086974-83086996 CTAGATCTGCAGTTCTCAAACGG - Intergenic
1130366957 15:83249384-83249406 CTAGACCAGTGATTCTCAACTGG + Intergenic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1130848869 15:87774074-87774096 CTACTTCAGTACTTCTCAACTGG - Intergenic
1131019014 15:89082150-89082172 CTAAACCAGTGGTTCTCAACTGG - Intergenic
1131305292 15:91237426-91237448 CTAGTGCAGTGGTTGTCAACTGG - Intronic
1131417041 15:92269126-92269148 CTGGTTCAGTAGGTCTGAAGGGG + Intergenic
1131421726 15:92311980-92312002 CTAGTCCAGTGGTTCTTAACTGG + Intergenic
1131467983 15:92670762-92670784 CTAAGGCAGAAGTTCTCAACTGG - Intronic
1131548545 15:93336360-93336382 TTAGATCAGTGGCTCTCAACTGG + Intergenic
1132075814 15:98818835-98818857 CTGGTCCAGTGGTTCTCAACAGG - Intronic
1132277447 15:100581420-100581442 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1133406759 16:5530756-5530778 CTAGAGCAGTGCTTCTCAACTGG - Intergenic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1133882695 16:9797935-9797957 CTAGGGCAGTGGTTCTCAAAGGG - Intronic
1133917155 16:10119541-10119563 CTAGCCCCGTGGTTCTCAACAGG + Intronic
1134135398 16:11673662-11673684 CTTGTTCAGTGGTTCTCAACTGG - Intronic
1134145499 16:11757520-11757542 TTAGCACAGTGGTTCTCAACTGG - Intronic
1134291701 16:12906926-12906948 CTAAGTTAGTGGTTCTCAACTGG - Intronic
1134322087 16:13173526-13173548 CTAGATCAGCAGTTCTTAACTGG + Intronic
1134360353 16:13525201-13525223 TTAGCTCAGTGGTTCTCAAAGGG - Intergenic
1134372791 16:13641112-13641134 CTAGACCAATGGTTCTCAACTGG + Intergenic
1134380187 16:13717097-13717119 CTAAACCAGTGGTTCTCAACTGG + Intergenic
1134394204 16:13848146-13848168 CTACAACAGTAGTTCTCAATTGG - Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135029305 16:19025234-19025256 CTAGAGCAGTGGTTCTCATCTGG - Intronic
1135080237 16:19427814-19427836 CTAGAGCAGTGGTTCTCAAGTGG - Intronic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135597819 16:23756649-23756671 ATAGATCAGTGATTCTCAACTGG + Intronic
1135885763 16:26305766-26305788 CTAGAGCAGTGGTTCTCAAACGG - Intergenic
1136106660 16:28034879-28034901 CTAGTATAGGGGTTCTCAACTGG - Intronic
1137294050 16:47073333-47073355 CTATAGCAGTGGTTCTCAACTGG + Intergenic
1137763123 16:50956617-50956639 CTACAGCAGTGGTTCTCAACTGG - Intergenic
1137917807 16:52452068-52452090 GTAGGTTAGTGGTTCTCAACTGG - Intronic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138197178 16:55060330-55060352 CTAGCCCAGTGGTTCTCAACAGG + Intergenic
1138344922 16:56314840-56314862 CTAGATCAGCGGTTCTCAAAGGG - Intronic
1138977584 16:62226422-62226444 CTATGTTAGTTGTTCTCAACAGG - Intergenic
1139034293 16:62924634-62924656 CTGGTTCAGTGGCTCTCAACTGG + Intergenic
1139137355 16:64220930-64220952 ATACATCAGTTGTTCTCAACTGG - Intergenic
1139261610 16:65599620-65599642 CTAGTTCAGTAACTCTCAAATGG - Intergenic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1139557324 16:67720517-67720539 CTAGACTAGTGGTTCTCAACTGG - Intergenic
1139646170 16:68332394-68332416 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140058022 16:71542845-71542867 CTACATGAGTGGTTCTCAACTGG + Intronic
1140220366 16:73039442-73039464 CTATTTCAGGTGTTCTTAACTGG + Intronic
1140251889 16:73301586-73301608 CTAGGCCAGTGGTTCTCAACTGG - Intergenic
1140304610 16:73791312-73791334 ATAGATCAGTAGTTCTCAAACGG + Intergenic
1140567561 16:76061828-76061850 CTATTTCAGTTGTCCTCAGCGGG + Intergenic
1140930354 16:79622073-79622095 GTAGAGCAGTGGTTCTCAACTGG - Intergenic
1141065244 16:80908749-80908771 ATAGCTCAGTTGTTCTCAACAGG - Intergenic
1141271596 16:82545893-82545915 CTAGGCCAGTGGCTCTCAACTGG + Intergenic
1141338323 16:83178359-83178381 CTAAATCAGTGGTTCTCAACTGG - Intronic
1141377311 16:83543607-83543629 CTAAGTCAGTGGTTCTCAACTGG + Intronic
1141737113 16:85861121-85861143 CTAATTCAGTAGTTCTCAACAGG + Intergenic
1142574613 17:898283-898305 CTAGGAAAGTGGTTCTCAACTGG - Intronic
1143691029 17:8566171-8566193 CTAGGTCAGTGGTTCTTAATTGG - Intronic
1143705087 17:8691898-8691920 CAAGGTCAGTGGTTCTCAGCTGG + Intergenic
1143832007 17:9660046-9660068 CTAGAGCAGTAGCTCTCAACTGG - Intronic
1144068762 17:11647807-11647829 CTAGATTAGTGGTTCTCAACTGG + Intronic
1144374998 17:14630394-14630416 ATATTTCAGTGGTTCTCAAATGG + Intergenic
1146239796 17:31209200-31209222 GTAATACAGTAGTTCTCAACTGG - Intronic
1146803880 17:35849692-35849714 CTAAGGCAGTGGTTCTCAACAGG - Intronic
1147361570 17:39934009-39934031 CTGGCTCAGTAGTTCTCAGGAGG - Intergenic
1147558030 17:41491911-41491933 ATAGTCCAATGGTTCTCAACTGG - Intronic
1148179610 17:45594729-45594751 TTAGTCCCGTGGTTCTCAACTGG - Intergenic
1148269296 17:46251169-46251191 TTAGTCCCGTGGTTCTCAACTGG + Intergenic
1148495741 17:48052666-48052688 CTAGGCCAGTGGTCCTCAACTGG + Intronic
1148541893 17:48487577-48487599 CTAAGTCAGTAGTTCTCAACAGG - Intergenic
1148601579 17:48898420-48898442 GTAGACCAGTAGCTCTCAACTGG - Intergenic
1149063068 17:52446946-52446968 CTAGCACAGTATTTCTCAACTGG + Intergenic
1149207764 17:54268184-54268206 CTAGCCCAGTGGCTCTCAACTGG + Intergenic
1149297122 17:55271097-55271119 CTAGACCAGTGGTTCTCCACCGG - Intronic
1149607138 17:57933066-57933088 CTAGTGCAGTGGTTCACAAGTGG - Intronic
1150301699 17:64052739-64052761 CTGGTTCTGTAGTTTTCAAAGGG + Intronic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151083029 17:71350321-71350343 GCAGTTCAGTGGTTCTCAAATGG + Intergenic
1151099649 17:71542170-71542192 CTACTTCAATAGCTCTGAACTGG + Intergenic
1151169636 17:72235894-72235916 GTAGAACAGTGGTTCTCAACTGG - Intergenic
1151185751 17:72362778-72362800 CTAAATCAGTGGTTCTCAACTGG + Intergenic
1151327592 17:73388676-73388698 TTAGTACAGTGCTTCTCAACTGG - Intronic
1152235732 17:79137430-79137452 CTGGGTCAGTGATTCTCAACAGG - Intronic
1153423374 18:4934139-4934161 GTAATGCAGTTGTTCTCAACTGG - Intergenic
1153860121 18:9194300-9194322 CTATATCAGTAGTTCTCAAATGG - Intronic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1154962356 18:21322290-21322312 CTAGATTAGTGATTCTCAACTGG + Intronic
1155688952 18:28592559-28592581 AAAGTGTAGTAGTTCTCAACTGG - Intergenic
1155969933 18:32073305-32073327 TTAGGCCAGTACTTCTCAACTGG + Intergenic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1156697927 18:39790047-39790069 ATAGTTCAGCAGTCCCCAACTGG - Intergenic
1157367830 18:47082391-47082413 TTAGTCCAGTGGTCCTCAACTGG - Intronic
1157686525 18:49646977-49646999 GTAGAGCAGTTGTTCTCAACTGG - Intergenic
1157796269 18:50578477-50578499 CTAGACCAGTGGTTCTCAAATGG - Intronic
1158020875 18:52840029-52840051 CTCGTTCATTAGTTCTCCAGTGG + Intronic
1158068410 18:53441128-53441150 CTAGCTCAGTGGTTTCCAACTGG - Intronic
1158953634 18:62520670-62520692 CTAGAGCAGGTGTTCTCAACAGG + Intergenic
1159892550 18:73966266-73966288 TTAAGGCAGTAGTTCTCAACTGG - Intergenic
1160241379 18:77125788-77125810 CTAGTTCAGTAGTGCTGAGAGGG + Intronic
1161305637 19:3565998-3566020 CTAGCTCAGTGGTTCTCATCCGG - Intronic
1161481955 19:4515580-4515602 TTAATTCAGTAGTTTTCAACTGG + Intronic
1161834353 19:6635557-6635579 CGAATTCAGTGGTTCTCAACTGG + Intergenic
1163047583 19:14655817-14655839 ATAGACCAGTGGTTCTCAACGGG + Intronic
1163207074 19:15811548-15811570 CTGGATCAGCGGTTCTCAACTGG - Intergenic
1163404591 19:17114142-17114164 CTAAAACAGCAGTTCTCAACTGG - Intronic
1163494345 19:17636870-17636892 CAAGTCAAGTTGTTCTCAACTGG - Intronic
1166175524 19:41066263-41066285 TTAGTTCAGTGTTTCTCAAAAGG + Intergenic
1166842830 19:45709205-45709227 TTTTTTCAGTTGTTCTCAACAGG + Intergenic
1167064438 19:47173720-47173742 ATAATCCAGTGGTTCTCAACTGG - Intronic
1167069057 19:47209058-47209080 CTAGGGCAGTGGTTCTTAACTGG - Intronic
1167116201 19:47490683-47490705 CTTGTCCAGTAGTTCTCAGAGGG - Intronic
1167534242 19:50039403-50039425 CTAGCCCAGCAGTTCTCAGCTGG + Intronic
1167854657 19:52227770-52227792 CTAGAGCAGTAGTTCTCAACTGG - Exonic
1168071633 19:53956407-53956429 ATAATTTAATAGTTCTCAACAGG + Intergenic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
925332316 2:3068125-3068147 TTAATCCAGTGGTTCTCAACTGG - Intergenic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
926159389 2:10477023-10477045 CTAGCCTAGTAGTTCTCAACTGG + Intergenic
926974303 2:18497772-18497794 TTAAAGCAGTAGTTCTCAACAGG - Intergenic
927872766 2:26634023-26634045 CTAGCTTAGTAGTTCTCAACGGG + Intronic
928074987 2:28255965-28255987 CTAGCTCAGAAGTTTTTAACAGG + Intronic
928227474 2:29464634-29464656 GTAGGGCAGTGGTTCTCAACAGG + Intronic
928421547 2:31140795-31140817 CTAGTTCTGTAGGTCTCTCCAGG + Intronic
929370557 2:41219235-41219257 TTAATGCAGTGGTTCTCAACTGG - Intergenic
929698657 2:44142304-44142326 TTAGAGCAGTAGCTCTCAACTGG + Intergenic
929849931 2:45577134-45577156 CTAGAGCAGTGGTTCTCAATGGG + Intronic
929969252 2:46559716-46559738 CTACAACAGTGGTTCTCAACTGG - Intronic
930333911 2:50021528-50021550 CTTCTTCACTATTTCTCAACGGG - Intronic
930588819 2:53302451-53302473 CTAGATCAGTGGTTCTAACCAGG - Intergenic
931112068 2:59122052-59122074 CTAGGCCAGTGGTTCTCAACTGG + Intergenic
931601300 2:64005753-64005775 CTAACTCAGTGGTTCTCAACCGG - Intronic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
932021465 2:68091618-68091640 TTTGATCAGTGGTTCTCAACTGG - Intronic
932105056 2:68934502-68934524 CTGAATCAGTAGTTTTCAACTGG - Intergenic
932254805 2:70275354-70275376 TTAGTTCAGTAATTCTTAACTGG + Intronic
932399668 2:71471309-71471331 TTAATACAGTAGTTCTCAACTGG + Intronic
933406118 2:81862051-81862073 TTAGTTCAGCAGTTTTCCACTGG + Intergenic
933744368 2:85560075-85560097 TTAGCCCAGTAGTTCTCAACTGG - Intronic
935682098 2:105647064-105647086 CTGGTGCAGTAGGTCTCAAAGGG + Intergenic
935787497 2:106562011-106562033 CTAAATCAGTGGATCTCAACAGG + Intergenic
936174622 2:110209009-110209031 CTAGAGCAGTAGTTTTCAACAGG - Intergenic
936937479 2:117852158-117852180 CTAGATCAATGGTTCTCAACTGG + Intergenic
937291140 2:120782847-120782869 CTACAGCAGCAGTTCTCAACCGG - Intronic
937587746 2:123574682-123574704 CTGGATCAGTATTTCTCAACAGG + Intergenic
937815046 2:126241993-126242015 CTAGCTCAGCAATTCTCAACTGG - Intergenic
937849646 2:126621035-126621057 CTGATACAGTAGTTCTCCACTGG - Intergenic
938925654 2:136039161-136039183 CGAAATCAGTAGTTCTCAACTGG - Intergenic
939293794 2:140230216-140230238 CTAGATCAGTAGTTCTGATCAGG + Intergenic
939328445 2:140725930-140725952 TAAATTCAGTAGTTCTCAAATGG + Intronic
939849565 2:147288308-147288330 CTATTTTAGTGGTTCTTAACAGG - Intergenic
939896124 2:147793181-147793203 TTAGCTCAATGGTTCTCAACTGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
940805764 2:158184856-158184878 CTGATTCAGTAGTTGTCAAGCGG + Intronic
941358815 2:164525931-164525953 CTATTGCAGTGGTTCTTAACTGG - Intronic
941744637 2:169073881-169073903 CTAGAACAGTGGTTCTAAACTGG + Intronic
941766456 2:169302424-169302446 CTAAATCAGTGGTTCTCAACTGG + Intronic
942019870 2:171856432-171856454 CTAGAGCAGTGGTTCTCAATAGG - Intronic
942293547 2:174496202-174496224 CTGTCACAGTAGTTCTCAACTGG + Intergenic
942571553 2:177320654-177320676 CCAGATCCGTGGTTCTCAACAGG - Intronic
942934148 2:181533628-181533650 CTAGAGCAGTGGTTCTCAGCAGG - Intronic
943737523 2:191373201-191373223 CTATTTCAGTGGTTCTCAAATGG + Intronic
944514478 2:200498649-200498671 CTAGTGCAGTGGTTCTCAACTGG - Intronic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
944610827 2:201404963-201404985 CTAGGGCAGTCTTTCTCAACAGG + Intronic
944773823 2:202941279-202941301 CTACTACAGTAGTTCTCAATTGG - Intronic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
946880915 2:224176322-224176344 TTAGCTCAGTGGATCTCAACTGG - Intergenic
946928100 2:224645555-224645577 CTAGATCAGCATTTCTAAACTGG - Intergenic
947185315 2:227449763-227449785 TTAGGTTAGTAGTTCTCAACTGG - Intergenic
947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG + Intergenic
947485696 2:230546697-230546719 CTAGTTCTCTATTTCTCACCTGG - Intergenic
947834967 2:233168856-233168878 CTAGGTCAGTGGTTCCCAAAGGG - Intronic
1169161267 20:3380611-3380633 CTAGTGCAGTAGTTCCCAACTGG - Intronic
1170015552 20:11777602-11777624 CTGATTCAGTAGGTCTCAGCTGG - Intergenic
1170713776 20:18814874-18814896 CTAGGCCAGTGGTTCTTAACTGG + Intronic
1170849489 20:19991571-19991593 TTACATCAGTGGTTCTCAACTGG - Intronic
1170934155 20:20795441-20795463 CTAGATCAGTGATTCTCCACTGG - Intergenic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1172361597 20:34316540-34316562 CAAGTTCAGGAGTTCACACCAGG + Intergenic
1172979947 20:38933481-38933503 CTAGGCCAGTGGTTCACAACTGG - Intronic
1173094595 20:40013021-40013043 CTAAATCAGTGGTTTTCAACTGG + Intergenic
1173172397 20:40737994-40738016 CTAGATCAATGATTCTCAACAGG + Intergenic
1173447732 20:43135063-43135085 CTAACTCAGTGGTTCTCAACTGG - Intronic
1173865749 20:46311712-46311734 CTAGAGCAGTGGCTCTCAACTGG - Intergenic
1174103258 20:48143399-48143421 CTAGACTAGTGGTTCTCAACTGG - Intergenic
1174203077 20:48820614-48820636 TTAGCCCAGTGGTTCTCAACTGG + Intronic
1174204806 20:48830423-48830445 TTACATCAGTGGTTCTCAACAGG - Intergenic
1174283482 20:49455880-49455902 CCAGACCAGAAGTTCTCAACGGG - Intronic
1174339260 20:49885926-49885948 CTAATTCAGTAGGTCTGAATGGG - Intronic
1174443011 20:50570891-50570913 CTAGAGCGGTGGTTCTCAACCGG - Intronic
1174517870 20:51107121-51107143 CCAGGTCAGCAGTTCTCAACTGG + Intergenic
1174603291 20:51741949-51741971 CTAGAGCAGGAGTTCTCAACTGG - Intronic
1174622528 20:51887034-51887056 TGAGATCAGTGGTTCTCAACTGG + Intergenic
1174647768 20:52100972-52100994 CTAGTCCAGTGGCTCTCAACTGG + Intronic
1174684187 20:52437850-52437872 CTAGTACAGTGGTTCTCAAGTGG - Intergenic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1174859521 20:54077436-54077458 CTACCCCAGTGGTTCTCAACGGG - Intergenic
1175050663 20:56152396-56152418 CTCACTCAGTGGTTCTCAACTGG - Intergenic
1175122048 20:56723308-56723330 CTAGTCCAAAGGTTCTCAACAGG - Intergenic
1175139970 20:56853752-56853774 CTAACCCAGTAGTTTTCAACTGG - Intergenic
1175197252 20:57252830-57252852 CTAAACCAGTGGTTCTCAACTGG + Intronic
1175246140 20:57583257-57583279 CTACATCAGTAGATCTCAGCTGG - Intergenic
1175270621 20:57731378-57731400 CTAGCCCAGTGGTTCCCAACTGG - Intergenic
1175417238 20:58809972-58809994 TTATCTCAGTGGTTCTCAACTGG - Intergenic
1175590333 20:60184848-60184870 CTATTCCAGTAGTTCTCAACCGG + Intergenic
1175663579 20:60838744-60838766 ACAGTTCAGTGGCTCTCAACTGG - Intergenic
1175721842 20:61292446-61292468 CTAGTCTAGTGGTTCTCAAAGGG + Intronic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1177650188 21:23950334-23950356 CTAGTCCAGTGGTTTGCAACTGG + Intergenic
1177888303 21:26773368-26773390 CTAATTCAGTGGTTCTCAACTGG - Intergenic
1178083927 21:29094085-29094107 CTAGGGCAATGGTTCTCAACTGG + Intronic
1178269404 21:31176012-31176034 TTAGGCCAGTAGTTCTCAACTGG + Intronic
1178761616 21:35408273-35408295 TTAGTCCAGGACTTCTCAACAGG - Intronic
1178812494 21:35896872-35896894 CTAGTGCAGTGGCTCTCAACTGG + Intronic
1178847155 21:36183324-36183346 CTACAGCAGTGGTTCTCAACTGG - Intronic
1179036817 21:37765353-37765375 CAAGATCAGTGGTTCTGAACTGG + Intronic
1179117981 21:38511946-38511968 CTGTTCCAGTGGTTCTCAACTGG - Intronic
1179389481 21:40974401-40974423 TTAAGACAGTAGTTCTCAACAGG - Intergenic
1179451480 21:41471342-41471364 TTAGGCCAGTAGTTCTCAACTGG + Intronic
1179841188 21:44075085-44075107 CTAACTCAGAAGATCTCAACAGG + Exonic
1180643510 22:17318706-17318728 CTGGTGCAGTGGTTTTCAACTGG + Intergenic
1180713208 22:17854137-17854159 CTAGATCCGTGATTCTCAACTGG + Intronic
1180986942 22:19910480-19910502 CTAGGTCAGTGGTTGTCAAATGG - Intronic
1181884914 22:26013174-26013196 CTATGTCAGTGGTTCTCAACTGG + Intronic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182530590 22:30953067-30953089 CTAGTTTAGTGCTTCTCAAAAGG - Intronic
1182779430 22:32855815-32855837 CTAATACAGTGGTTCTCAACTGG - Intronic
1182886090 22:33775481-33775503 CTAAGTCAGTGGTTCTCAATAGG + Intronic
1182912354 22:33995577-33995599 CTAGGGCTGTAATTCTCAACAGG - Intergenic
1183193532 22:36337125-36337147 TTAGTCCAGTAGTTCTTAACTGG + Intronic
1183271302 22:36864240-36864262 CTATCTCAGTGGTTCTCAACAGG + Intronic
1183430028 22:37759743-37759765 CTAGGACAGCGGTTCTCAACGGG + Intronic
1184665997 22:45989399-45989421 TTAGACCAGTGGTTCTCAACTGG - Intergenic
949343306 3:3052417-3052439 GTAGCTCAGTGGTTTTCAACAGG - Intronic
949348249 3:3097503-3097525 CTGGTGCAGTGATTCTCAACTGG + Intronic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
949834523 3:8253657-8253679 ATAATCCAGTAGTTCTCAAAGGG + Intergenic
950963137 3:17126472-17126494 CTAGATCAGTCATTCTCAACTGG - Intergenic
951048842 3:18071857-18071879 CTAAATCAGTACTTCTCAACTGG - Intronic
951511876 3:23511310-23511332 CTAACACAGTGGTTCTCAACAGG - Intronic
951551278 3:23877615-23877637 TTAGAGCAGTGGTTCTCAACTGG - Intronic
951563457 3:23989880-23989902 CTAGTACAGTGGTTCTCAAAGGG + Intergenic
951685676 3:25341612-25341634 TTAAATCAGTAGTTCTCAACTGG + Intronic
951905845 3:27706792-27706814 CTCATCCAGTAGTTCTCAGCTGG + Intergenic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
952521870 3:34168942-34168964 CTAGGGCAGTGGTTCTGAACTGG + Intergenic
952553288 3:34503062-34503084 CTATGACAGTAGTTGTCAACTGG - Intergenic
954079887 3:48207431-48207453 CAGGATCAGTGGTTCTCAACTGG + Intergenic
954198415 3:49009645-49009667 CTAATCCAGTGGTTCTCCACAGG - Intronic
954422928 3:50428090-50428112 TTAGGCCAGTGGTTCTCAACTGG + Intronic
954789318 3:53119519-53119541 CTAGCACAGTGGTTGTCAACTGG + Intronic
955065311 3:55528914-55528936 CTAAGTCAGCAGTTCTCAACCGG - Intronic
955376862 3:58404538-58404560 ATAGGTCAGTAGCTCTCAACTGG - Intronic
955709638 3:61764797-61764819 CTAGAGAAGTAGTTCTCAAGTGG + Intronic
955761770 3:62292617-62292639 TTAGAGCAGTAGTTCTCAATTGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955867700 3:63402360-63402382 TTAGAGCAGTGGTTCTCAACTGG - Intronic
955981781 3:64534690-64534712 CTAAATCAGTGGTTCTCAACAGG + Intronic
955986964 3:64583676-64583698 ATAATTCAATAGTTCTCAATTGG - Intronic
956376078 3:68614984-68615006 CTACAGCAGTCGTTCTCAACTGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956707930 3:72015385-72015407 CTAGTCCAGTGATTCTCAACTGG - Intergenic
956734714 3:72229385-72229407 CTAGGGCAGTGGTTTTCAACCGG - Intergenic
956763518 3:72464328-72464350 CTAGTTTCATAGTTCTCTACTGG + Intergenic
957202144 3:77149517-77149539 CGAGTTCAGTACTTGTCAAGTGG + Intronic
957424967 3:80025511-80025533 CCATTTCAGTTGTTCTCAGCAGG + Intergenic
957857807 3:85900733-85900755 CTAGTTCCATAGCTCTCATCCGG + Intronic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
958991527 3:100851538-100851560 CTGGAGCAGTAGTTCTCAAATGG - Intronic
959245826 3:103866296-103866318 TTAGATCAGCAGTTCTCATCTGG - Intergenic
959983155 3:112541012-112541034 CTAATGCAGTGATTCTCAACTGG + Intronic
960188082 3:114669038-114669060 CCAATTCAGTGGTTCTTAACTGG + Intronic
960466205 3:117998687-117998709 ATAGATAAGAAGTTCTCAACTGG - Intergenic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
960724221 3:120653994-120654016 CCAGGTCAGTGGTTCTCAACTGG - Intronic
961642154 3:128371500-128371522 TTAGACCAGTGGTTCTCAACTGG - Intronic
961661541 3:128471207-128471229 CTAAATCAGTGGTTCTCAACAGG + Intergenic
962034136 3:131632915-131632937 CTAGGTCAGTGGTTCTCCACTGG - Intronic
962416748 3:135189716-135189738 GTAGAACAGAAGTTCTCAACTGG + Intronic
962853315 3:139323942-139323964 CTAGGACAGAGGTTCTCAACTGG - Intronic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
963756769 3:149242610-149242632 TTAGTACAGTGGTTCTCTACAGG + Intergenic
963883532 3:150554641-150554663 CTAGATCAGTGGTTCTTAAAGGG - Intronic
964039266 3:152239162-152239184 CTACTTCAGTAGTTTTAAAGTGG + Intergenic
964215763 3:154279684-154279706 CTTGGGCAGTGGTTCTCAACTGG - Intronic
964723867 3:159794463-159794485 CTAATGCAGTGATTCTCAACAGG + Intronic
964880086 3:161413533-161413555 CTATTTCTGTAGTTCTCAGCAGG + Intergenic
964899889 3:161645683-161645705 CTAATCCAATAGTTCTCAACTGG - Intergenic
965407399 3:168287250-168287272 CTAATTCAGTAGCTCCTAACTGG - Intergenic
965515031 3:169612120-169612142 CTAGATTAGTGATTCTCAACTGG - Intronic
965515511 3:169617400-169617422 CTAGTTCAGTAGATCTGAGATGG + Intronic
966737414 3:183198773-183198795 CTAGGTCAGTGTTTCTCAAAGGG - Intronic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
967359338 3:188611753-188611775 CTAGCTCAGTACCTCTCACCAGG - Intronic
967428574 3:189355492-189355514 CTGGTCCAGTATTTCACAACAGG - Intergenic
967671618 3:192242457-192242479 CTACTTCAGTGGTTCTCAACTGG - Intronic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
967750692 3:193112584-193112606 CCAGGACAGTAGTTTTCAACTGG + Intergenic
970433792 4:16013636-16013658 CTATACCAGTGGTTCTCAACTGG + Intronic
970681608 4:18514918-18514940 TTAGATCATTACTTCTCAACTGG + Intergenic
970761031 4:19486726-19486748 CTACACCAGTAGTTCTAAACCGG - Intergenic
971116165 4:23647861-23647883 CTACAGCAGTACTTCTCAACCGG + Intergenic
971219810 4:24694458-24694480 TTAACCCAGTAGTTCTCAACTGG - Intergenic
971723508 4:30277853-30277875 TTCATTCAGTGGTTCTCAACTGG - Intergenic
972174708 4:36389103-36389125 CTAGTTCACTAATGCCCAACAGG - Intergenic
972291133 4:37690986-37691008 CCAGCTCAGTGGTTATCAACTGG - Intergenic
972842131 4:42943753-42943775 CTAGGTCAGTGGCTCTCAAGTGG + Intronic
973980776 4:56306613-56306635 CTAGAGCAGTGGTTCTCAGCTGG + Intronic
973988642 4:56380895-56380917 CTAAAGCAGTAGTTCTCAACTGG - Intronic
974619033 4:64331974-64331996 CTTTTTCAGTTGTTCTCAGCAGG - Intronic
974882163 4:67773366-67773388 CTAGTGTAGTGGTTCTCAATGGG + Intergenic
975818591 4:78245998-78246020 CTAGTCCTGTAGTTCTCAAAAGG - Intronic
975885479 4:78959508-78959530 CTAAATCAACAGTTCTCAACTGG + Intergenic
976466122 4:85370528-85370550 CCAGTTCAGTGGTTCTGAACTGG + Intergenic
976485720 4:85601599-85601621 TTAATACAGTGGTTCTCAACTGG - Intronic
976568310 4:86578099-86578121 CAAGATCAGTGGTTTTCAACTGG + Intronic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
977184009 4:93914566-93914588 TTAGATCAGTGGTTTTCAACTGG - Intergenic
977302331 4:95282009-95282031 CTAGACCTGTGGTTCTCAACTGG - Intronic
977560312 4:98526316-98526338 CTAGTTCAGATGTTTTCACCTGG - Intronic
977593536 4:98852672-98852694 CTAAATCAGTGGTTCTCAACTGG - Intergenic
978602426 4:110442904-110442926 GTAGGTCAGTAGTGATCAACTGG - Intronic
978608668 4:110511465-110511487 GTAGATGAGTAGTTTTCAACTGG - Intronic
978742420 4:112152173-112152195 CTAAATCAGTGGTTCTCAACTGG + Intronic
979225925 4:118284307-118284329 CTAGGTCAGAGGTTCTCAACTGG - Intronic
979969904 4:127121832-127121854 CTGACCCAGTAGTTCTCAACTGG + Intergenic
980027923 4:127788613-127788635 CTAGGGCAGAGGTTCTCAACTGG + Intronic
980410917 4:132417676-132417698 CTAATTCAGAAGTTATCAAAAGG - Intergenic
981013955 4:139954012-139954034 CTAATTCAGTAGTTCTGAGGTGG + Intronic
981715501 4:147747890-147747912 CTAGACCAGTGGTTCTCAAATGG + Intronic
981912703 4:150000308-150000330 ATAGAGCAGTAGTTCTCACCTGG + Intergenic
982653556 4:158118254-158118276 CTAAAGCAGTGGTTCTCAACTGG + Intergenic
982793953 4:159623622-159623644 CTAGCTTAGTGGTTCTCAACTGG - Intergenic
983513052 4:168629569-168629591 GTAATTCAGTAGTTCTGAGCAGG + Intronic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
985141370 4:186843510-186843532 CCAGAGCAGCAGTTCTCAACTGG + Intergenic
985936693 5:3102917-3102939 TTAGTTCATTAGTTCACAACAGG - Intergenic
986445037 5:7814300-7814322 TTAGTGCAGTGATTCTCAACTGG + Intronic
986489798 5:8277640-8277662 GCAGAGCAGTAGTTCTCAACCGG - Intergenic
986770481 5:10968408-10968430 CTAGAGTAGTGGTTCTCAACTGG + Intergenic
987171412 5:15262284-15262306 CTAATTCAGTAAGTCTGAACTGG - Intergenic
987204961 5:15615444-15615466 CGAATGCAGCAGTTCTCAACTGG - Intronic
987340194 5:16933147-16933169 CTAGCTCAGTGGATCTCAACTGG + Intronic
987788467 5:22533135-22533157 CTGTATCAGTGGTTCTCAACAGG + Intronic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
988318388 5:29660775-29660797 CTAGTTAAGAAGTGCTCAGCTGG - Intergenic
989375598 5:40756716-40756738 CGACATCAGTGGTTCTCAACGGG - Intergenic
989620160 5:43376259-43376281 CTAGACCAGTTGTTTTCAACTGG + Intergenic
990026415 5:51196400-51196422 CTATGTCAGTGGTTCTCAACTGG + Intergenic
990166881 5:53004190-53004212 TTAGTGCAGTGGTGCTCAACTGG - Intronic
990371750 5:55126646-55126668 CTAAATCACTAGTTCTCAAAGGG + Intronic
990386616 5:55270175-55270197 CTAGACTAGTAGTTCTCAACTGG - Intronic
990459956 5:56022197-56022219 CTAGTTCAGTAGTTTCCAAAAGG - Intergenic
990609694 5:57444805-57444827 CTAGAGCAGTGGTTCTCAGCTGG - Intergenic
990858185 5:60295672-60295694 TTAGCTCAGTGGTTCTCAACTGG - Intronic
991023710 5:62007752-62007774 CTAGATCAGTGTTTCTCAACTGG - Intergenic
991196252 5:63935910-63935932 TTGGATCAGTGGTTCTCAACTGG - Intergenic
991380138 5:66012955-66012977 CTAAACCAGTGGTTCTCAACTGG + Intronic
991466158 5:66914724-66914746 CTAGGACAGTGGGTCTCAACTGG + Intronic
991682859 5:69155846-69155868 TTAATCAAGTAGTTCTCAACTGG - Intergenic
992007342 5:72490816-72490838 CAAGTTCAGTAGTTCTCAACTGG - Intronic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
993071771 5:83173741-83173763 CTAGTTAGGTTGTTCTCAACTGG - Intronic
994221892 5:97205803-97205825 ATATTTTAGTAGTTCACAACTGG - Intergenic
994996770 5:107073771-107073793 CTAGTTCTACAGATCTCAACCGG - Intergenic
995596626 5:113754277-113754299 CTACATCAGTGGTTTTCAACTGG - Intergenic
995879695 5:116830563-116830585 CTGGTGCAGTAGTTCTGAAGGGG - Intergenic
995913519 5:117215899-117215921 CTATATCAGTGGTTTTCAACTGG + Intergenic
996135524 5:119837302-119837324 CTAAGTCAGGAGTTCTTAACTGG - Intergenic
996658158 5:125966639-125966661 CTAGTTCATGACCTCTCAACTGG + Intergenic
997783126 5:136679854-136679876 TTAGAACAGTAGTTCTCAACTGG - Intergenic
997992243 5:138554282-138554304 TTAAGCCAGTAGTTCTCAACTGG + Intergenic
998100585 5:139430363-139430385 CTAATCCAGCAGTTCTCAAAGGG - Intronic
998573327 5:143285303-143285325 ATAGATCAGTGGTTCTCAAAAGG + Intronic
998585263 5:143420542-143420564 CTAGAACACTAGTTTTCAACTGG + Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999057611 5:148596703-148596725 CTAGAGCAGTACTTCTCAACTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999522999 5:152371750-152371772 CTAGTCCAGTTATTCTCATCTGG - Intergenic
999626386 5:153525181-153525203 CTAGTGCAGTGATTCTCAGCTGG + Intronic
999647626 5:153734941-153734963 CTAACTTAGTGGTTCTCAACTGG + Intronic
999783862 5:154873786-154873808 CTAGGTCAGTGATTCTCAACTGG + Intronic
999821437 5:155232950-155232972 CTAGCCCAGTGGTCCTCAACTGG + Intergenic
999840668 5:155422384-155422406 CTAGATCAGTTGTTCTCAACAGG - Intergenic
999930131 5:156422848-156422870 TTACATCAGTGGTTCTCAACTGG - Intronic
1000124169 5:158227161-158227183 GTAGATCAGTGGTTTTCAACTGG + Intergenic
1000363763 5:160472268-160472290 CCAGAGCAGTGGTTCTCAACTGG - Intergenic
1000397141 5:160787820-160787842 CTAGATCAGAAGTTATAAACTGG + Intronic
1000398660 5:160802374-160802396 CTATATCAGTGGTTCTCAACTGG + Intronic
1000577391 5:162991183-162991205 CTAGATCAGTGGTTTTCAACTGG + Intergenic
1000600580 5:163269745-163269767 TTAGTTCTGCAGTTCTCAAAAGG - Intergenic
1000904850 5:166952667-166952689 ATAGAGCAGTGGTTCTCAACTGG - Intergenic
1000986695 5:167868278-167868300 CTAGCTCAGTCATTCTCCACTGG - Intronic
1001127064 5:169029329-169029351 CTAGTTCATTTGTTCTCAAAGGG + Intronic
1001139384 5:169131448-169131470 CTAATTTAGTGGTTCTCATCTGG - Intronic
1001435984 5:171699744-171699766 TTAGAACAGTTGTTCTCAACTGG - Intergenic
1002720045 5:181253478-181253500 CTACATCAGTGGTTCTCAACTGG + Intergenic
1003030547 6:2597023-2597045 CTGGTGCAGTGGTTCTCAGCCGG - Intergenic
1003034106 6:2628219-2628241 TTAAGTCAGTGGTTCTCAACTGG + Intronic
1004828808 6:19454408-19454430 CTAGTTCAGAAAATATCAACTGG - Intergenic
1004925984 6:20415567-20415589 CTAGTTCGGTGGTTCTCAGCTGG - Intronic
1004927407 6:20428946-20428968 GTAGACCAGTGGTTCTCAACTGG + Intronic
1006047601 6:31310401-31310423 CTTGTCCAGTAGTACTCAATGGG - Intronic
1006817777 6:36864565-36864587 CTAGCCTAGTGGTTCTCAACGGG + Intronic
1007119424 6:39367833-39367855 TTGGTTCAATGGTTCTCAACTGG + Intronic
1007497727 6:42272511-42272533 CTGATTCAATAGATCTCAACTGG - Intronic
1007502649 6:42310459-42310481 GTGGAGCAGTAGTTCTCAACAGG + Intronic
1007914906 6:45552374-45552396 CTAGCTAAGTGGTTCTCAATCGG - Intronic
1008129673 6:47706487-47706509 ATAGGACAGTGGTTCTCAACTGG + Intronic
1008158615 6:48049093-48049115 CCAGAGCAGTGGTTCTCAACAGG + Intronic
1008401127 6:51064322-51064344 CTAGAATAGTAGTTCTCAACTGG - Intergenic
1008418235 6:51267876-51267898 CTAGTTCAGTGGTTCTGAATTGG - Intergenic
1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG + Intergenic
1008762403 6:54868386-54868408 CAAGTTCAGTGGTTCTCAAAAGG - Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1010374490 6:75150899-75150921 CTAATGCAGTGATTCTCAACTGG + Intronic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1011574753 6:88783866-88783888 TTAGATCAGTGATTCTCAACTGG - Intronic
1011585468 6:88919985-88920007 AGGATTCAGTAGTTCTCAACTGG + Intronic
1011776023 6:90731483-90731505 CTAACTCAGTGGTTCTCAACTGG - Intergenic
1011998345 6:93621733-93621755 CTATTTCAGTGGATCTTAACTGG + Intergenic
1012195751 6:96340029-96340051 CTAATGCAGTGGTTCTTAACTGG - Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1012642774 6:101640796-101640818 CTAGATCAGTGATTCTCAAGTGG - Intronic
1013109944 6:107056918-107056940 CTAATGCAGTGGTTCTCAACTGG - Intergenic
1013152225 6:107457631-107457653 CTAGAGCACTGGTTCTCAACTGG - Intronic
1013779712 6:113716120-113716142 ATACTTGAGTAGTTCTTAACTGG - Intergenic
1014119769 6:117711503-117711525 CTAGTGCAGTGGTTCTCACCTGG + Intergenic
1014125471 6:117772046-117772068 CTAGGGCAATTGTTCTCAACAGG - Intergenic
1015054350 6:128882397-128882419 CTAGGTCAGTGGTTCTCATAAGG - Intergenic
1015189687 6:130459282-130459304 CTATAGCCGTAGTTCTCAACTGG + Intergenic
1016673083 6:146731176-146731198 GTAGGTGAGTAGTTCTCAACTGG - Intronic
1017256619 6:152340596-152340618 CTAGCGCAGTGGTTCACAACTGG - Intronic
1018166430 6:161101798-161101820 CTAGAGCAATAATTCTCAACTGG - Intronic
1018431808 6:163728820-163728842 CTAGCCCAGTGGTTCTCAACTGG + Intergenic
1018591089 6:165423523-165423545 CTAGGTCAGTGCTTCTCAATAGG - Intronic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1020911473 7:14137223-14137245 CTAGAGCAGCAGTTCTGAACAGG + Intergenic
1021206144 7:17783472-17783494 CTAAATCAGTAGTTTTCAACTGG - Intergenic
1021248602 7:18295720-18295742 GTAGACCAGTAGTTCTCAACCGG + Intronic
1021470093 7:20992123-20992145 GTAATTCATTAGTTTTCAACTGG + Intergenic
1021554482 7:21905315-21905337 CTAGTGCAGTAATTCCCATCTGG - Intronic
1021799254 7:24287589-24287611 CTAAATCAGTGGTTCTCAACTGG + Intronic
1021882576 7:25108851-25108873 GTAGCCCAGTGGTTCTCAACTGG - Intergenic
1021936245 7:25635046-25635068 CTAAAGCAGTGGTTCTCAACCGG + Intergenic
1021940353 7:25672957-25672979 CTTGCTCAGTGGTTCTCAGCTGG + Intergenic
1022331748 7:29385717-29385739 TTAGGCCAGTGGTTCTCAACTGG - Intronic
1022353815 7:29591980-29592002 ATAGGTCAGTATTTCTCAAAGGG - Intergenic
1022678791 7:32524807-32524829 CTAGTCCAGTAGTTATCACTGGG - Intronic
1022828321 7:34039355-34039377 CTAGTACTCTAGTTCTCAACTGG + Intronic
1023031896 7:36096892-36096914 CTAGGTCAGTAATTTTCCACTGG - Intergenic
1023082423 7:36537886-36537908 CTAGGCCAGTGGTTCTCAACTGG - Intronic
1023583709 7:41707291-41707313 CTACAGCAGTGGTTCTCAACCGG + Intergenic
1024924551 7:54599329-54599351 TTAGAGCAGTGGTTCTCAACTGG + Intergenic
1025223085 7:57132919-57132941 CTAGTTCAGGAGTTCGAGACAGG + Intronic
1025633884 7:63304583-63304605 CTAGTTCAGGAGTTCGAGACAGG + Intergenic
1025648813 7:63443585-63443607 CTAGTTCAGGAGTTCGAGACAGG - Intergenic
1026065972 7:67073175-67073197 TTAAATCAGTGGTTCTCAACTGG + Intronic
1026331818 7:69358681-69358703 CAAGTTCAGCAGTTGTCAGCAGG + Intergenic
1026427279 7:70308695-70308717 TTAGAACAGTAGTTCTCAACTGG + Intronic
1027130945 7:75590975-75590997 CTAAAGTAGTAGTTCTCAACTGG + Intronic
1027433064 7:78134166-78134188 ATAAAACAGTAGTTCTCAACGGG - Intronic
1027546505 7:79533319-79533341 CTAGTTCTGTGGTTCTCAATTGG - Intergenic
1028125140 7:87104298-87104320 CTAGATCAGTGATTCTCAAAGGG - Intergenic
1030014621 7:105206236-105206258 CTAGTGCACTGGTTCTCAATGGG - Intronic
1030266008 7:107622642-107622664 GTAAATCAGTAGTTCTCAACAGG + Exonic
1031498525 7:122482233-122482255 GTAATTCTGTGGTTCTCAACTGG + Intronic
1031964507 7:128017986-128018008 CTACTTCAGCAGTTCCCCACTGG - Intronic
1032433054 7:131878613-131878635 CCAGGACAGTGGTTCTCAACAGG - Intergenic
1032485393 7:132283275-132283297 CCAGTTACATAGTTCTCAACAGG - Intronic
1033166711 7:139045249-139045271 CTAGTTCAGTGGTTTTCAATGGG - Exonic
1033820621 7:145130336-145130358 CTATACCAGTTGTTCTCAACAGG - Intergenic
1034593051 7:152160251-152160273 CTAGTTCTGTGGCTCTCAAGGGG + Intronic
1034988248 7:155530929-155530951 CTATGCCAGTGGTTCTCAACTGG - Intronic
1036188453 8:6646816-6646838 TTAGGTCAATGGTTCTCAACTGG - Intergenic
1036616101 8:10388947-10388969 CTAGTTCAGTGATTCTCAACTGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1036738738 8:11342428-11342450 CAAGTTCAGTAGTTATCAAACGG - Intergenic
1037536151 8:19826692-19826714 CTAAGTCAGTGGTTCTCCACTGG + Intronic
1037853224 8:22349957-22349979 TTAGTGAAGTGGTTCTCAACTGG + Intronic
1038159008 8:25019019-25019041 TTAGCCCAGTGGTTCTCAACAGG - Intergenic
1038500255 8:28037792-28037814 CTAGACCAGTGATTCTCAACCGG + Intronic
1038624412 8:29177043-29177065 TTAGACCAGTGGTTCTCAACTGG + Intronic
1040436284 8:47394437-47394459 CTAGGATAGTGGTTCTCAACTGG + Intronic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1042662351 8:71168879-71168901 CTACATCAGTGGTTCTCAAAGGG + Intergenic
1043174473 8:77007023-77007045 CTAGTTCAGAATTTCTCACAAGG - Intergenic
1043291375 8:78605718-78605740 CTAGATCAGTGGTTCTAAAGTGG - Intergenic
1043534334 8:81185452-81185474 CTAACTCAGTGGCTCTCAACTGG + Intergenic
1043838291 8:85069421-85069443 CTAGACCAGCAGTTCTCAAAGGG + Intergenic
1043948193 8:86277887-86277909 CTAGTCCAGTAGTTGTCACTGGG + Intronic
1044075705 8:87819952-87819974 CTATGTCAGTAGTTTTCAACTGG - Intergenic
1045506624 8:102783149-102783171 CTGGTTCTCCAGTTCTCAACTGG - Intergenic
1045908068 8:107372290-107372312 TTATATCAGTAGTTCTCAGCTGG - Intronic
1046771296 8:118119015-118119037 CTAGATTAGTGGGTCTCAACTGG - Intergenic
1047126400 8:121966227-121966249 TTAGGTCACTAGGTCTCAACTGG + Intergenic
1047318806 8:123759363-123759385 CTAAACCAGTAGTTCTCAACTGG - Intergenic
1047564747 8:126031767-126031789 CTAGAGCAGTGGTTATCAACCGG - Intergenic
1047889334 8:129290615-129290637 CTAATTCAGTAGTTTTCCATCGG - Intergenic
1047905966 8:129473729-129473751 CTAGGCCAGTGGTTCTCAGCTGG + Intergenic
1048713630 8:137242290-137242312 CTAACTCAGTGCTTCTCAACTGG - Intergenic
1049928713 9:434999-435021 TTAGAGCAGTGGTTCTCAACTGG + Intronic
1050844696 9:10200290-10200312 ATAGATCAGTGGTTTTCAACTGG + Intronic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1052838179 9:33266788-33266810 CTAGTTCAGTTTTTCCCAGCAGG - Intronic
1052961887 9:34305569-34305591 ATAATTAAGTAGTTGTCAACAGG - Intronic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1053192358 9:36083124-36083146 ATAGTCCAGTGGTTCTCCACAGG - Intronic
1053207648 9:36200471-36200493 CTAGTTCAACAGTTCCCAAGAGG - Intronic
1054778685 9:69146655-69146677 TTAGGTCAGTGGTTGTCAACGGG + Intronic
1054897534 9:70330366-70330388 TTAGACCAGTGGTTCTCAACTGG - Intronic
1055275352 9:74609793-74609815 CTAGAACAGTGGTTGTCAACTGG + Intronic
1055936331 9:81607780-81607802 CTAGTTCATGGGTACTCAACTGG + Intronic
1056261287 9:84851199-84851221 CTAGGTCAGTGGTTCTCAAACGG - Intronic
1056370316 9:85947555-85947577 TTAGATTAGTGGTTCTCAACTGG + Intronic
1057149808 9:92786243-92786265 CTAAACCAGTGGTTCTCAACTGG - Intergenic
1057396145 9:94682297-94682319 CTGATTCAGTAGGTCTCAAGAGG + Intergenic
1057734235 9:97638873-97638895 CTACAGCAGTAGTTCTCAACAGG - Intronic
1057998743 9:99844221-99844243 CTGGGGCAGTAGTTCTCAATTGG + Intronic
1058428324 9:104895539-104895561 CTAGAGCAGTGGTTCTCGACCGG - Intronic
1058650122 9:107167791-107167813 CTAGCCCAGTGGTTCTGAACTGG + Intergenic
1058849601 9:108998117-108998139 CTATCCCAGGAGTTCTCAACTGG + Intronic
1058957950 9:109966808-109966830 CTGGTTCAGTAGGTCTCAGGCGG + Intronic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1059148563 9:111925600-111925622 CTAGGTCAGTGCTTCTCAACTGG - Intronic
1059214653 9:112549717-112549739 CTAAGTCAGTGGTTCTCAAATGG + Intronic
1059396456 9:114037018-114037040 CTAGAGCAGTGGTTCTCAAAGGG - Intronic
1059759149 9:117321927-117321949 TTACAGCAGTAGTTCTCAACAGG - Intronic
1059795983 9:117697279-117697301 TTAGAATAGTAGTTCTCAACTGG - Intergenic
1059850059 9:118328102-118328124 CTACAACAGTGGTTCTCAACTGG - Intergenic
1060633683 9:125182854-125182876 CTAGACCAGTCGTTCTCAACTGG - Intronic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1186514975 X:10160171-10160193 CTCAATCAGTGGTTCTCAACAGG - Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186608208 X:11112753-11112775 CTACATCAGTGGTTCTTAACTGG + Intronic
1186617596 X:11205427-11205449 GCAGGTCAGTTGTTCTCAACTGG - Intronic
1186620803 X:11238051-11238073 ATAGACCAGTGGTTCTCAACTGG - Intronic
1186624637 X:11279935-11279957 CTAGCTTAGTAGTCCTCTACTGG + Intronic
1186638878 X:11434002-11434024 CTAGGCCAGTGATTCTCAACAGG + Intronic
1186762935 X:12742149-12742171 TTAGCCCAGTGGTTCTCAACTGG + Intergenic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1186888917 X:13941016-13941038 CTAGTTCAGGGGTTCTTGACTGG + Intergenic
1186900105 X:14045351-14045373 CTATAGCAGTATTTCTCAACTGG + Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187029521 X:15471326-15471348 CTATGTCAGTGGTTCTCAACTGG - Intronic
1187040879 X:15594500-15594522 TTATGTCAGTGGTTCTCAACTGG - Intronic
1187354611 X:18555277-18555299 CTAGTTCAATAGTTCTCCCTTGG - Intronic
1187722206 X:22162946-22162968 CTAAAGCAGTAGTTCTCAGCTGG + Intronic
1187826821 X:23339938-23339960 GTAAGGCAGTAGTTCTCAACCGG + Intronic
1187978472 X:24729386-24729408 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1188024358 X:25193335-25193357 CTAGAGCAGCGGTTCTCAACTGG - Intergenic
1188251022 X:27894363-27894385 CTACAACAGTAGTTCGCAACTGG - Intergenic
1188260722 X:28019960-28019982 CTAGACCAGTGGTTGTCAACTGG - Intergenic
1188535262 X:31190076-31190098 CTAGGTCGGTGGTTCTCAACCGG + Intronic
1188604845 X:32015560-32015582 CTAGAGTAGTAGTTCTCAAAGGG - Intronic
1189162557 X:38825311-38825333 CTACACCAGTAGTTCTCGACTGG - Intergenic
1189647933 X:43154443-43154465 CTGATTCAGTAGTTCTAAAATGG + Intergenic
1189719031 X:43896004-43896026 CTAGAGCAGTGGTTCTCAATAGG - Intergenic
1190787533 X:53666202-53666224 CTAATTCAGTAGGTCTGAAGTGG + Intronic
1192258758 X:69490147-69490169 ATAAGTCAGTGGTTCTCAACTGG + Intergenic
1194131861 X:90091218-90091240 CTAGTCCAGTAGTTATCATTGGG - Intergenic
1195011618 X:100737747-100737769 CTTGACCAGTGGTTCTCAACTGG - Intergenic
1195110062 X:101639540-101639562 CTAGACCAGGTGTTCTCAACTGG - Intergenic
1195281560 X:103339668-103339690 CTAGATCAGGCGTTCTCAACTGG - Intergenic
1195363378 X:104106159-104106181 CTAGTACAGTGGTTCTAAGCCGG - Intronic
1195537535 X:106025915-106025937 CTAAGACAGTAGTTCTCAATGGG + Intergenic
1195546597 X:106119148-106119170 CTAGTCCAGTAGTTGTCATTGGG + Intergenic
1195574302 X:106432555-106432577 CTAGAGCAATGGTTCTCAACTGG - Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1195853145 X:109305026-109305048 CTAGATCAGTTATTCTTAACTGG - Intergenic
1195996593 X:110737855-110737877 CAACTACAGTAGTTCTCAACTGG + Intronic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1196868294 X:120088785-120088807 TCAGTTCAGTAATTCTCAACAGG - Intergenic
1197189259 X:123627401-123627423 CAAGAGCAGTAGTTCTCAAGAGG - Intronic
1197199601 X:123736471-123736493 GTAGCTCAGTGGTTCTCAAAAGG - Intergenic
1197330748 X:125151672-125151694 CTAAGCCAGTAGATCTCAACTGG + Intergenic
1197358150 X:125462575-125462597 CTAAGTCAGTGATTCTCAACTGG - Intergenic
1198318160 X:135490431-135490453 CTGGTTCAGTGATTCTCAACTGG + Intergenic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1199084419 X:143612203-143612225 ACAGATCAGTAGTTGTCAACTGG - Intergenic
1199201433 X:145094669-145094691 CTAGAATAGTAGTTCTCAACTGG + Intergenic
1199778424 X:151036060-151036082 CTAATGCAGTGGTTCTCAAGGGG - Intergenic
1199923537 X:152436477-152436499 ATAATTCAGTGGTTCCCAACTGG - Intronic