ID: 1012278379

View in Genome Browser
Species Human (GRCh38)
Location 6:97300204-97300226
Sequence TTGGCTTCCCACACACAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012278379_1012278384 1 Left 1012278379 6:97300204-97300226 CCATGTTGTGTGTGGGAAGCCAA No data
Right 1012278384 6:97300228-97300250 CATAGAAACCAGGCTGGGCATGG No data
1012278379_1012278380 -9 Left 1012278379 6:97300204-97300226 CCATGTTGTGTGTGGGAAGCCAA No data
Right 1012278380 6:97300218-97300240 GGAAGCCAAACATAGAAACCAGG No data
1012278379_1012278383 -4 Left 1012278379 6:97300204-97300226 CCATGTTGTGTGTGGGAAGCCAA No data
Right 1012278383 6:97300223-97300245 CCAAACATAGAAACCAGGCTGGG No data
1012278379_1012278385 4 Left 1012278379 6:97300204-97300226 CCATGTTGTGTGTGGGAAGCCAA No data
Right 1012278385 6:97300231-97300253 AGAAACCAGGCTGGGCATGGTGG No data
1012278379_1012278381 -5 Left 1012278379 6:97300204-97300226 CCATGTTGTGTGTGGGAAGCCAA No data
Right 1012278381 6:97300222-97300244 GCCAAACATAGAAACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012278379 Original CRISPR TTGGCTTCCCACACACAACA TGG (reversed) Intergenic
No off target data available for this crispr