ID: 1012286360

View in Genome Browser
Species Human (GRCh38)
Location 6:97393806-97393828
Sequence CACTCCTCAAATCTACTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012286360_1012286362 12 Left 1012286360 6:97393806-97393828 CCTGAAAGTAGATTTGAGGAGTG No data
Right 1012286362 6:97393841-97393863 CATTAGTGGAACCATTAGAGAGG No data
1012286360_1012286363 18 Left 1012286360 6:97393806-97393828 CCTGAAAGTAGATTTGAGGAGTG No data
Right 1012286363 6:97393847-97393869 TGGAACCATTAGAGAGGTGTAGG No data
1012286360_1012286361 -2 Left 1012286360 6:97393806-97393828 CCTGAAAGTAGATTTGAGGAGTG No data
Right 1012286361 6:97393827-97393849 TGTGAGATGAACAGCATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012286360 Original CRISPR CACTCCTCAAATCTACTTTC AGG (reversed) Intergenic
No off target data available for this crispr