ID: 1012290083

View in Genome Browser
Species Human (GRCh38)
Location 6:97443630-97443652
Sequence CTGGCTCCCCAGATGTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012290078_1012290083 4 Left 1012290078 6:97443603-97443625 CCATTCTTCATCACGGCCTCTAC No data
Right 1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG No data
1012290076_1012290083 25 Left 1012290076 6:97443582-97443604 CCACTTTTTTTTTTTTTTTTTCC 0: 22
1: 402
2: 7692
3: 45826
4: 61002
Right 1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012290083 Original CRISPR CTGGCTCCCCAGATGTAGCA TGG Intergenic
No off target data available for this crispr