ID: 1012290083 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:97443630-97443652 |
Sequence | CTGGCTCCCCAGATGTAGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012290078_1012290083 | 4 | Left | 1012290078 | 6:97443603-97443625 | CCATTCTTCATCACGGCCTCTAC | No data | ||
Right | 1012290083 | 6:97443630-97443652 | CTGGCTCCCCAGATGTAGCATGG | No data | ||||
1012290076_1012290083 | 25 | Left | 1012290076 | 6:97443582-97443604 | CCACTTTTTTTTTTTTTTTTTCC | 0: 22 1: 402 2: 7692 3: 45826 4: 61002 |
||
Right | 1012290083 | 6:97443630-97443652 | CTGGCTCCCCAGATGTAGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012290083 | Original CRISPR | CTGGCTCCCCAGATGTAGCA TGG | Intergenic | ||
No off target data available for this crispr |