ID: 1012294323

View in Genome Browser
Species Human (GRCh38)
Location 6:97501680-97501702
Sequence CCATTTATCAAACACCGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012294321_1012294323 30 Left 1012294321 6:97501627-97501649 CCATATTCAGGAGTGAGGTATGA No data
Right 1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012294323 Original CRISPR CCATTTATCAAACACCGACC AGG Intergenic